Labshake search
Citations for Takara Bio :
1 - 50 of 1497 citations for Solute Carrier Family 12 Member 1 SLC12A1 Antibody APC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... GenTLE Precipitation Carrier (TaKaRa) with incubation at -80°C for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... GenTLE Precipitation Carrier (Takara). These purified ribosome footprint RNAs were ligated with linker oligonucleotides containing an inner index sequence and a unique molecular identifier (UMI) ...
-
bioRxiv - Microbiology 2022Quote: ... GenTLE precipitation carrier (Takara Bio) were added to the DNA solution and pelleted by centrifugation at 12,000 × g for 15 min at 4 °C ...
-
bioRxiv - Genomics 2023Quote: ... GenTLE Precipitation Carrier (Takara, #9094) and centrifuged for 15 min at 12000 r.p.m ...
-
bioRxiv - Microbiology 2021Quote: ... GenTLE precipitation carrier (Takara BIO, Tokyo, Japan). The concentration and purity of the DNA were measured with a DS-11FX+ Spectro/Fluorometer (DeNovix ...
-
bioRxiv - Biophysics 2022Quote: ... YeastMaker DNA carrier 50 μg (Takara Bio), supplemented with 1 μg of pYeDP60 vector) ...
-
bioRxiv - Cell Biology 2024Quote: ... 250 μL of DNA after sonication were incubated with 1 μL of DNA carrier (ST0029, TakaRa Bio), 25 μL of BSA 5% (BP1600 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 50 μg of denatured Yeastmaker™ Carrier DNA (Clontech). The cells were incubated with PEG4000 buffer (40% [w/v] PEG4000 ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Biochemistry 2020Quote: ... and the PCR products recovered were connected with pMD-19T carrier(Takara, Janpan), then converted to DH5 alpha receptive cells (Vazyme ...
-
bioRxiv - Immunology 2023Quote: ... SMART MMLV reverse transcriptase (639524) and carrier DNA (630440) were purchased from Clontech, Takara Bio ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μL of Yeastmaker Carrier DNA (10 mg/mL, #630440, Takara Bio, Kusatsu, Japan), 1 μL of genome-editing plasmid (200–600 ng) ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Immunology 2021Quote: ... Global macrophage depletion was carried out using the homodimerizer AP20187 at 10 mg/kg in carrier solution by subcutaneous injection (Cat. # 635058, Clontech) with carrier-treated controls (4% EtOH ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 12S Set A (Takara, R400695). Size selection steps were performed with Magbio Genomics HighPrep PCR beads (Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... the supernatant obtained by centrifugation at 12,000 × g for 20 min at 4°C was applied to the column purification using immobilized metal affinity chromatography (IMAC) with a cobalt ion carrier (TALON metal affinity resin, Takara Bio Inc.). Antiserum was produced in a rabbit by immunization with the FoIV1-rORF4 (Eurofins Genomics).
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP monoclonal antibody (Takara, # 632375; 1:2,000), Bip2 antibody (Agrisera ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP antibody (Clontech, rabbit, 1:2000), anti-Ago1 antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody (cat # 632380, 1: 2,000, Clontech) and horseradish peroxidase (HRP)-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Genomics 2023Quote: ... Antibody list: FOXG1 (rabbit, 1:200, Takara) and PAX6 (mouse ...
-
bioRxiv - Immunology 2024Quote: ... Retronectin-coated (overnight, 12 µg/mL, Takara) Non Tissue Culture flat bottom plates (24 well ...
-
bioRxiv - Neuroscience 2024Quote: ... the primary antibody was anti-dsRed antibody (dilution 1:1000, Clontech, Cat #632496), and the second antibody was goat anti-rabbit conjugated with Cy3 (Jackson ImmunoResearch ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... differentiated HUES9 hESCs (Passage 12-18; RRID:CVCL_0057) were plated on 12-well iMatrix-511 (Cat.No. T303; Takara Bio Inc) coated plates at a density of approximately 3 x 106 cells/well in Synaptojuice medium (adapted from 124 ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-DsRed antibodies (1:3000, Takara, 632496). Sections were washed three times in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used: DsRed (Rabbit, 1:2000, Clontech), VGLUT1 (Guinea Pig ...
-
bioRxiv - Immunology 2022Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), rabbit anti-Lcp1 (1:1000) ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% normal donkey serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6xHN Polyclonal Antibody (1:2000, Takara, CA, USA) at 4°C for overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... and primary antibodies STEM121 (1:500) (Takara #Y40410), ANXA1 (1:400) ...
-
bioRxiv - Genomics 2021Quote: ... Non-tissue culture treated 12-well plates were prepared by incubating 1 mL PBS + 25 μg/mL Retronectin (Takara) overnight at 4°C ...
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... The viral 5’UTR with the 12 aa region and the 12 aa region on its own were cloned into pAcGFP1-C1 (Takara Biotech) using restriction-free cloning ...
-
bioRxiv - Immunology 2024Quote: ... Retroviral supernatants were then spun for 1 h at 3100g at 4 °C in 12-well-plates coated with 32 mg/ml RetroNectin (Takara). Meanwhile ...
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Developmental Biology 2021Quote: ... stained with anti-GFP antibody (1/800, 632592, Clontech) and biotinylated anti-rabbit IgG (1/200 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies against mCherry (Mouse, Clontech, 632543; 1/500), GFP (rabbit polyclonal anti-GFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed antibody (Clontech, 632496, 1:100 dilution), Guinea pig anti-Period antibody (Gift from Amita Sehgal ...
-
bioRxiv - Pathology 2022Quote: ... Primary antibodies: rabbit anti-DsRed express (Clontech, 1:250) and goat anti-HRP (Jackson Lab ...