Labshake search
Citations for Takara Bio :
301 - 350 of 518 citations for Siglec 15 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... MTase expression was then induced at 15°C according to the Cold Shock Expression System pColdTM DNA’s protocol (Takara Bio). 24 hours after the induction ...
-
bioRxiv - Cell Biology 2021Quote: ... and the mouse Mon1b cDNA was amplified from the Marathon-Ready adult mouse brain and testis cDNAs (Clontech/Takara Bio, Shiga, Japan) by conventional PCR techniques ...
-
bioRxiv - Cell Biology 2021Quote: ... and the mouse Mon1b cDNA was amplified from the Marathon-Ready adult mouse brain and testis cDNAs (Clontech/Takara Bio, Shiga, Japan) by conventional PCR techniques ...
-
bioRxiv - Microbiology 2021Quote: ... mouse monoclonal antibody against EGFP (Clontech, Mountain View, CA) was used for western blotting at a dilution of 1:1,000 and rabbit polyclonal antiserum reactive against protein kinase A (PKA ...
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with α-MYC (mouse, 1:500, Clontech #631206) in 4 % BSA-PBS for 60 min at room temperature to stain surface expressed GluK2 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (JL8 - Takara cat# 632381, RRID: AB_2313808), mouse anti-E-cadherin (HecD1-provided by M ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies against mCherry (Mouse, Clontech, 632543; 1/500), GFP (rabbit polyclonal anti-GFP ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (632375, Takara Bio Inc., Otsu, Japan), mouse anti-FLAG (F3165 ...
-
bioRxiv - Neuroscience 2020Quote: ... we used the normalized mouse brain library (Clontech Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... mouse monoclonal antibody against EGFP (Clontech, Mountain View, CA) was used for Western blotting at a dilution of 1:1,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse monoclonal anti-GFP (Clontech; milk; 1:2,000).
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-DSRed (targeting mCherry; 1:2000; Clontech), washed ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse α-GFP JL-8 (cat. no. 632381, Takara) used at a concentration of 1:2,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... membranes were incubated with mouse anti-GFP (Clontech #632380), rabbit anti-DsRed (Takara #632496) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti GFP (mouse monoclonal, JL8, Clontech; WB: 1:6000), anti-human tubulin (mouse monoclonal ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse monoclonal anti-GFP (JL8, Clontech, 632381, 1:1000) mouse monoclonal anti-vinculin (SantaCruz ...
-
bioRxiv - Biophysics 2024Quote: ... and blotted with anti-GFP/YFP antibody (mouse, Clontech) at 1:5000 dilution overnight at 4° C on a rocking platform ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed on 1 μL of 1 in 40 diluted cDNA in 15 μL reactions using SYBR Premix Ex-Taq II reagent (Takara Bio) in a Bio-Rad CFX96 real-time system (see Table S1 for primer pairs) ...
-
bioRxiv - Bioengineering 2020Quote: ... with specific primers (Suppl. Table 1) from pP121K-AcGFP1 [15] and inserted between the SalI and BglII sites of pTRE3G (Takara Bio) using NEBuilder HiFi DNA Assembly Mater Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL of the cDNA was used as DNA template in 15-µL amplification volumes with 400 nM of each primer and 7.5 µL of SYBR green master mix (Takara, Beijing, China) using the following cycling parameters ...
-
bioRxiv - Genetics 2023Quote: ... Molecular cloning was performed using PCR to generate fragments with 15 bp overlapping ends and then assembling the fragments using In-Fusion Enzyme (Takara Bio) prior to transformation into chemically competent E ...
-
bioRxiv - Genomics 2023Quote: ... Primers were designed with around 15 bp of overlapping sequence to ensure proper circularization with the In-Fusion HD cloning plus kit (Takara #638909). Mach1 competent cells (Thermo Fisher Scientific #C862003 ...
-
bioRxiv - Microbiology 2020Quote: ... human NLRP1 TEV or mouse NLRP1B (mouse strain 129 allele, NCBI accession AAZ40510.1) were cloned into the pQCXIP vector backbone (Takara Bio, Mountain View, CA) with a C-terminal Myc tag ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were mouse anti-STEM121 (1:500; Takara), chicken anti-GFAP (1:2,000 ...
-
bioRxiv - Genomics 2020Quote: ... as well as the Mouse total RNA Master panel (Clontech), were used to study the level of expression of candidate lncRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), rabbit anti-GFP (Chromotek ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2022Quote: ... a mouse anti-mCherry primary antibody (Takara Bio, 1:5000) was used instead of the substance P primary antibody to visualize hM3Dq-mCherry or mCherry-expressing cells.
-
bioRxiv - Systems Biology 2022Quote: ... living colors mouse anti-GFP (632681, Clontech, Mountain View, CA), goat anti-GFP (ab5450 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-mCherry (1:200, Takara Bio/Clontech Laboratories, 632543), rat anti-BrdU (1:250 ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GFP antibody (Clontech, clone JL8, used at 1:4,000) was obtained from Takara (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), mouse anti-Dhc (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-mCherry (1:200, Takara Bio/Clontech Laboratories, 632543), rat anti-BrdU (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... a Living Colors® EGFP mouse monoclonal antibody (632569, Clontech), or a mouse monoclonal anti-actin antibody (clone AC-40 ...
-
bioRxiv - Microbiology 2023Quote: ... Immunoblotting was performed using mouse anti-eGFP (Takara, 1:2000), rabbit anti-Actin (Bethyl ...
-
bioRxiv - Developmental Biology 2021Quote: ... 9 ul from each samples were directly used for cDNA amplification (15 cycles of LD PCR, using the SMART-Seq v4 Ultra Low Input RNA kit for sequencing (Takara Bio, #634898) and the SeqAmp DNA Polymerase (Takara Bio #638509) ...
-
bioRxiv - Immunology 2020Quote: ... The locus containing exons 11 through 15 of Copa was amplified off RP24-64H24 with FseI flanking ends and ligated into pEasyFloxDTA with Infusion recombination (Takara Bio USA) to form the 3’ homology arm.
-
bioRxiv - Cell Biology 2019Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... The forward primer contained a Kozak sequence and both primers contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). To make pmCherry-N1-Gal3 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was extracted from the whole bodies of a pool of 15 AM-treated larvae using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... the fragments of the pcAGGS/pcDNA3.1 vector and each target gene were amplified with a 15 bp homologous arm and were then fused using the In-Fusion HD Enzyme (Clontech, Felicia, CA, USA). To create the pcAGGS-huANP32B-Δ216/190/165 plasmids ...