Labshake search
Citations for Takara Bio :
1 - 50 of 321 citations for SARS Coronavirus Nucleoprotein N Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed to insert these linear fragments into the pMV306 previously digested with EcoRV and transformed into Escherichia coli (E. coli) Stellar TM competent cells (Takara Bio), purified (NucleoSpin Plasmid ...
-
bioRxiv - Systems Biology 2023Quote: ... Ligated plasmid products were transformed into stellar competent cells (E. coli HST08 strain, Takara Bio). See Table S1 for full descriptions of constructs.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... was used as the wild-type (WT) strain for genetic manipulations. Chemically competent Escherichia coli (E. coli) DH5α and HST08 (Stellar Competent Cells, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) were used as the host strains for molecular cloning.
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Genomics 2021Quote: ... coli HST08 (used to test coregulation of genes in newly-formed operons and for vector construction; E. coli HST08 Premium Competent Cells, Takara Bio, Japan, 9128).
-
bioRxiv - Microbiology 2020Quote: ... coli (Clontech), extracted and retransformed into EAW19 ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 N and E genes were transcribed from the pBluescript-N and pUC57-E plasmids by adding a T7 promoter via PCR using Premix Taq (Cat. No. R004A, TAKARA, Shuzo, Shiga, Japan). The crRNA templates were amplified from a pUC57-T7-crRNA (Supplementary Table S10 ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Takara) and selected on LB-Ampicillin plates ...
-
bioRxiv - Biochemistry 2020Quote: ... coli cells (TaKaRa) were transformed with these plasmids for amplification and DNA storage ...
-
bioRxiv - Microbiology 2021Quote: ... coli DH5α (Takara) or Stellar™ (Takara ...
-
bioRxiv - Cell Biology 2022Quote: ... coli (Clontech 636763) via heat shock ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... coli (Takara,#9027) were transformed using electroporation and the subcloned library was obtained by combining 4 maxipreps ...
-
bioRxiv - Microbiology 2021Quote: ... coli DH5α (Takara) and Stellar™ (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar (Takara) and E ...
-
bioRxiv - Cell Biology 2022Quote: ... coli (Takara Bio). Plasmids were purified by miniprep (Qiagen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli Stellar (Takara) cells on LB- or M9 minimal-agar supplemented with 1 mM IPTG were inoculated into 250 μL of the same liquid medium and grown in a 1.5-mL 96-deep well plate at 240 rpm for ~10 generations ...
-
bioRxiv - Genomics 2023Quote: ... coli (Takara Bioscience). 1% of the transformed cells were plated on ampicillin-agar plates to ensure adequate transformation efficiency (at least 10-fold library coverage) ...
-
bioRxiv - Genomics 2023Quote: ... coli (Takara, 636763) and 10 colonies were picked at random to ensure that each colony was unique ...
-
bioRxiv - Biochemistry 2020Quote: ... full-length (1-1143) or C-term (620-1143) was inserted into pGBKT7 (Clontech, Mountain View, CA) using SmaI/SalI restrictions sites ...
-
bioRxiv - Immunology 2021Quote: pVAX1-SARS-CoV2-co was designed by Takara, which encoded a highly optimized DNA sequence encoding the SARS-CoV-2 Spike glycoprotein ...
-
bioRxiv - Physiology 2020Quote: ... coli Stellar cells (Clontech/Takara Bio USA Inc. ...
-
bioRxiv - Bioengineering 2019Quote: ... coli BL21 (DE3) (TaKaRa, hsdS ...
-
bioRxiv - Biophysics 2020Quote: ... coli (TOYOBO or TaKaRa), calf intestine (Roche) ...
-
bioRxiv - Bioengineering 2019Quote: ... coli cells (Stellar, TaKaRa) were used for all cloning steps and were grown in LB medium supplemented with antibiotics as required - ampicillin (100 μg/mL) ...
-
bioRxiv - Microbiology 2021Quote: ... coli Stellar™ (Takara) following standard protocols [56] ...
-
bioRxiv - Microbiology 2019Quote: ... coli strain StellarTM (ClonTech), prior to isolation and transformation into COH1 GBS ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa), grown in LB medium at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa). A synthetic version of the E ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (Takara Bio) and positive clones were identified via RFP selection before sequencing to confirm the cloning was successful.
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar cells (Takara) for non-R6K origin of replication-based vectors or PIR2 cells (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... coli HST08 (Takara Bio). The pLI50_pgl plasmid was then isolated and transformed by electroporation into the restriction-deficient strain RN4220 ...
-
bioRxiv - Genomics 2022Quote: ... coli cells (Takara Bio) and plasmid was prepared following standard protocols ...
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar (Takara Bio) cells and plated on selective Luria-Bertani (LB ...
-
bioRxiv - Developmental Biology 2023Quote: ... coli (Takara Bio, 636763) via ampicillin-resistant selection ...
-
bioRxiv - Genomics 2023Quote: ... coli cells (Takara Bioscience). Sanger sequencing (Genewiz ...
-
bioRxiv - Developmental Biology 2023Quote: ... coli (Takara Bio, 636763). DNA was extracted by miniprep (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... coli Stellar cells (Clontech) and plated onto Luria Bertani agar supplemented with 25 µg/ml chloramphenicol ...
-
bioRxiv - Microbiology 2023Quote: ... coli StellarTM (Takara Biosciences) was used for cloning and plasmid storage ...
-
bioRxiv - Biophysics 2023Quote: ... coli BL21 (DE3, Takara).
-
bioRxiv - Bioengineering 2024Quote: ... coli DH5α (Takara Bio) was used for molecular cloning and cultivated in Luria-Bertani (LB ...
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-E-Cadherin (TAKARA; M110), rat anti-Endomucin (Santa Cruz ...
-
bioRxiv - Molecular Biology 2023Quote: ... and ORF66-TurboID were subcloned into the BamHI and NotI sites of pcDNA4 3xHA (C-term) using InFusion cloning (Clontech). TurboID-ORF34 was subcloned into the NotI and XhoI sites of N-term 3xHA pcDNA4 ...
-
bioRxiv - Immunology 2022Quote: ... pmCherry-N’ (Clontech) between NheI and HindIII restriction sites ...
-
bioRxiv - Cell Biology 2019Quote: ... coli pG-KJE8/BL21 (TAKARA) at 23 °C using the previously created pQE60-Rab11 vector (Li et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... coli Stellar competent cells (Clontech). Inserts of all plasmids were sequenced from E ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli (Takara Biosciences, Cat#636763) at an efficiency of 1.79×109 cfus/µg ...