Labshake search
Citations for Takara Bio :
651 - 700 of 823 citations for Recombinant Rabbit TNF Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated with primary antibody (anti-Th [mouse] 1:1500, Immunostar; anti-dsRed [rabbit] 1:1500, Clontech) overnight at RT shaking ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or a rabbit anti-DsRed polyclonal antibody (1:1000, Cat # 632496, RRID:AB_10013483, Takara Bio U.S.A., Inc., CA, U.S.A.). In addition ...
-
bioRxiv - Neuroscience 2023Quote: ... the following primary antibodies were used: rabbit anti-dsRed (1:1,000, Cat.# 632496, Clontech Laboratories, Mountain View, CA), chicken anti-GFP (1:10,000 ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified MBP-mEGFP/mCherry-Seb1 and MBP-mEGFP/mCherry-Rhn1 proteins were incubated with HRV 3C protease (Takara; 1 U/1 g of target recombinant proteins ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Genomics 2020Quote: ... and Living Colors DsRed Polyclonal Antibody (rabbit anti-E2-Crimson, Clontech [now Takara Bio USA], Mountain View, CA, USA). Sections were washed and stained with the secondary antibodies Streptavidin:Alexa Fluor 488 (Biolegend ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies for embryo staining were used at the following final dilutions: rabbit anti-DsRed (1:400, Clontech 632496), rat anti-tropomyosin (1:200 ...
-
bioRxiv - Microbiology 2022Quote: ... Aer01 tagged with dTomato were labeled by incubating larvae in blocking solution containing Rabbit anti-dsRed (Takara Bio #6324960) at 1:500 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-nc82 (1:50; Developmental Studies Hybridoma Bank) and rabbit anti-RFP (1:1000; TaKaRa Bio USA, #632496) at room temperature with agitation for 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... The next primary antibodies were used at the specified concentrations: rabbit anti-Dsred Pab (Takara Bio Cat# 632496, RRID:AB_10013483) [1:500] ...
-
bioRxiv - Neuroscience 2023Quote: ... the solution was replaced with a 0.5% BSA and 0.2% Triton X/PBS solution (PBST) containing a 1:1,000 dilution of Rabbit anti-DsRed (Takara, #632496) or Chicken Polyclonal anti-GFP antibody (Abcam ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Brain sections were transferred to positively charged glass histology slides (Fisherbrand) and immunostained with mCherry (rabbit-anti-DsRed; Takara Bio ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
A GID E3 ligase assembly ubiquitinates an Rsp5 E3 adaptor and regulates plasma membrane transportersbioRxiv - Cell Biology 2021Quote: ... pGADCg- and pGBKCg-based plasmids containing the indicated protein fusions were transformed into the yeast strain Y2HGOLD (Takara Bio), and double transformants were selected by growth on SD media lacking leucine and tryptophan ...
-
bioRxiv - Cell Biology 2021Quote: ... red fluorescent protein fused with the mitochondrial targeting sequence from cytochrome c oxidase subunit VIII (Clontech, Mountain View, CA) using Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of 6X-Histidine tagged cavin proteins was done using TALON metal affinity resin (ClonTech, Scientifix Cat No. 635503). Talon resin was thoroughly washed with 500GF buffer containing 5 mM imidazole to remove detergent and non-specifically bound proteins ...
-
bioRxiv - Plant Biology 2022Quote: Y2H protein interaction assays were performed according to the manufacturer’s instructions as described in the Yeast Protocols Handbook (Clontech; TaKaRa Bio USA ...
-
bioRxiv - Molecular Biology 2022Quote: ... red fluorescence protein (DsRed) and NK-NT or NKN1 fragments were cloned into pET6xHN-N Vector (Takara, CA, USA). HEK293T cells were cultured in FP medium (DMEM containing 10% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal loading of the GFP tagged E2F1 proteins was determined by the GFP antibody (Clontech, lot. 1404005; 1:2000) the secondary antibody anti-rabbit HRP (Na934v ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-TEV tagged protein was captured with Co-TALON resin (Clonetech, Takara Bio USA, 2 mL slurry/liter culture) at 4 ºC for 1 h with constant end-to-end mixing ...
-
bioRxiv - Microbiology 2023Quote: ... The protein-bead mixtures were then loaded onto a gravity column (TALON 2 mL Disposable Gravity Column, Takara #635606). Lysate was loaded into the column 5 times with gravity flow and then washed in a 1M NaCl buffer 3 times ...
-
bioRxiv - Biochemistry 2024Quote: ... The other 2A proteins were separated from the lysate using immobilized metal affinity chromatography with either TALON beads (Clontech) or chelating Sepharose beads charged with NiCl2 (Cytiva) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% normal donkey serum) for 1h at room temperature followed by incubation in primary antibodies (rabbit anti Ds-red, Takara, cat# 632496 ...
-
bioRxiv - Physiology 2021Quote: ... Brain sections were then incubated overnight at room temperature in blocking solution containing primary antiserum (rat anti-mCherry, Life Technologies M11217, 1:1,000; rabbit anti-dsRed, Clontech 632496 ...
-
bioRxiv - Neuroscience 2019Quote: ... the slices were incubated overnight at 4°C with a rabbit polyclonal antibody against DsRed (1:1000, Takara Bio USA) diluted in a blocking solution of 0.3% Triton X-100 in PBS-DEPC ...