Labshake search
Citations for Takara Bio :
301 - 350 of 1854 citations for Recombinant Mouse Scavenger Receptor Class B Member 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-mCherry monoclonal antibody (1:500; Takara Bio Cat# 632543), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs for C-terminal GFP-tagged human RHBDL4 were generated by subcloning into pEGFP-N1 (Clontech). For generating point mutants ...
-
bioRxiv - Cell Biology 2019Quote: GFP-tagged SAF-A alleles were cloned into the lentiviral expression vector pLVX-TetOne-puro (Takara) using In-Fusion cloning ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Molecular Biology 2020Quote: The extracted RNA was treated with Recombinant DNase I (Takara Bio, Japan) to digest the remaining genomic DNA and was purified by phenol/chloroform/isoamyl alcohol (25:24:21 ...
-
bioRxiv - Microbiology 2020Quote: ... Purification tags were removed by treating recombinant proteins with HRV3C protease (TaKaRa) and cOmplete™ His-tag Purification Resin (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 mM dNTP and 2 U/mL of recombinant RNase inhibitor (Clontech) then spun down and frozen at −80°C ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant DmNobo was expressed with the pCold-III plasmid vector (TaKaRa Bio) in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... Free DNA was removed via DNase treatment (Recombinant DNase I; Takara, Japan). Viral DNA was extracted using the DNeasy Blood & Tissue Kits (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant plasmids were co-transformed into yeast Y2H Gold strain (Takara). The transformed yeast strains were grown on DDO (SD/-Leu/-Trp ...
-
bioRxiv - Immunology 2023Quote: The recombinant Lenti-X™ pLVX-IRES lentiviral vector expression system (TakaRa) was used to introduce Wuhan-Hu-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at-80°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant CML13 and CML14 were purified via Ni-NTA His60 (Takara Biosciences.) and CaM7 using phenyl-sepharose (Sigma Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... 0.1mM EDTA) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B). Nuclei were counted and kept on ice (or for longer storage at - 80°C) ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant cholix toxin was first purified on nickel metal affinity chromatography (Takara) and subsequent TEV protease-mediated 6His-MBP tag removal at 4°C/Over Night (ON) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Both soluble and insoluble (cell pellet) fractions were purified via His-IDA nickel column (Clontech Laboratories ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the SMARTer Stranded Total RNA HI Mammalian kit (Takara 634873) with 0.5-1ug of RNA and samples were sequenced on the NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...
-
bioRxiv - Biophysics 2023Quote: WT and R203M N175-245were purified using the TALON His-tag purification protocol (Clontech Laboratories). Cell pellets were lysed in high salt buffer (50 mM tris ...
-
bioRxiv - Plant Biology 2023Quote: ... The yeast transformants were grown on nutrient-restricted (without Trp, Leu, His, Ade) mediums (Clontech) 3-5 days to assess interactions between various protein combinations.
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...
-
bioRxiv - Biophysics 2019Quote: ... The mEos3.2 tagged constructs used here are in Clontech N1 plasmid vector background (Clontech, Mountain View, CA).
-
bioRxiv - Cell Biology 2022Quote: ... the resulting Myc-tagged versions were then cloned into the BamHI site of pEGFP-N3 (Clontech Laboratories). Finally ...
-
bioRxiv - Microbiology 2020Quote: N-terminally Strep TagII tagged ZIKV Capsid was cloned to pLVX-TetOne-Puro Vector (Clontech, Cat: 631849) using BamHI & EcoRI cut sites ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were treated with 100ug/mL hygromycin B (Takara bio 631309). Cells were exposed to 100ug/mL hygromycin B for 8 days ...
-
bioRxiv - Immunology 2020Quote: ... plates were coated with 40 μg/mL retronectin (TAKARA, # T100A/B) overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with mouse anti-GFP (1:500, Takara Bio, 632380), rabbit anti-mCherry (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in primary antibody (1:1,000 mouse anti-calbindin, Sigma; 1:500 rabbit anti-DsRed, Clontech; 1:1,000 guinea pig anti-vGluT1 ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected either with GluK3EM or co-tansfected with Wild type/mutant receptors along with GFP expressing plasmid (2 µg/dish) using Xfect reagent (Clontech). Currents were recorded from medium sized cells expressing a moderate level of fluorescence from either the fused EGFP in case of GluK3EM or co-expressed EGFP and having a capacitance of ∼5-6 pF at 48-60 hours post transfection ...
-
bioRxiv - Immunology 2020Quote: ... The entirety of each of the annotated intracellular domains was ordered as a separate gene fragment (Integrated DNA Technologies) and each complete receptor was cloned into pHR lentiviral expression vector (Clontech). Each region of the protein was amplified using PCR and fragments were combined using Gibson assembly.
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant plasmids were transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763), and positive colonies were selected on LB plates containing spectinomycin (100ug/mL ...
-
bioRxiv - Microbiology 2022Quote: ... The thrombin-digested recombinant NA was incubated with TALON metal affinity resin (Takara) for 2 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and homogenization (NIM2 buffer supplemented with Recombinant RNase Inhibitor (0.4 U/μL, Takara), SUPERase in (0.2 U/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant plasmid was transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763) according to the manufacturer’s protocol and positive colonies were selected on LB plates containing kanamycin (50 μg/mL).
-
bioRxiv - Pathology 2020Quote: ... followed by treatment with 10 U of recombinant DNase I (Cat.#2270A, TaKaRa) to remove residual DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... the MEFs were transduced using a replication defective recombinant retroviral expression system (Clontech) with either wild-type (Parl WT ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 0.1 U/μL of recombinant RNase inhibitor (wash buffer-RIn, Takara). Mechanical cell lysis was achieved by mixing each sample with 0.1 mm glass beads and grinding in a Retsch mixer mill at a frequency of 30/s for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was produced using an Adenovirus Dual Expression Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Extracted RNA (20µg) was treated with recombinant DNase I (RNAse free) (Takara, Japan) and then cleaned-up using RNeasy spin column (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... The extracted RNA was treated with Recombinant DNase I (2270A, Takara, Shiga, Japan), and 2 ng equivalent was synthesized using Super Script 3 Supermix (18080400 ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were harvested and purified using TALON His-Tag Purification protocol (Clontech Laboratories, Mountain View, CA.) The SUMO tag was cleaved by Ulp-1 as described above and the protein was further purified using ion-exchange chromatography (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Plant Biology 2020Quote: ... The E.coli-expressed tNPR1-His protein was extracted and purified using TALON Metal Affinity Resin (Clontech). For rabbit immunization ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases ...