Labshake search
Citations for Takara Bio :
401 - 450 of 878 citations for Recombinant Mouse Erbb2 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry for mCherry (mouse, 1:1000, Takara; goat anti-mouse-alexa594 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse-anti-mCherry (Clontech, 632543 1:1000). Secondary antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:200; Clontech #632381) overnight at 4⁰C ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-Cherry (1:500; Clontech, 632543), Rabbit anti-Gat (1:4,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Clone JL-8; Clontech) at 1:1,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: ... or mouse α-GFP antibody (632381, Takara) were diluted 1:2000 in Odyssey Blocking Buffer (PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-STEM121 (Takara, Y40410, 1:250), goat anti-ChAT (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-mCherry (632543, Clontech; 1:500), mouse anti-GFP (ab1218 ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP (mouse, Clontech cat# 632380; 1:2,000); FLAG (mouse ...
-
bioRxiv - Cancer Biology 2021Quote: ... human MSI1 cDNA was amplified with the primers of MSI1_BamHI-F and MSI1_stopdead_XbaI-R (Table S6) using the PrimeScriptTM 1st strand cDNA Synthesis (Takara, 6210A) and PrimeSTAR ® Max DNA Polymerase kits according to manufacturer instructions (Takara ...
-
bioRxiv - Genetics 2020Quote: The final stitching PCR was performed using primers csrL-f and csrR-r with LA Taq polymerase (Takara) in a 50 μl reaction ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR products of stage 2 ray florets using c25599_g2_i1 Fill-F and c25599_g2_i1 Fill-R primers (Table S2) were digested with SacI (Takara Bio Inc). Reaction mixture was consisted of 2.5 µL of PCR product ...
-
bioRxiv - Cell Biology 2019Quote: ... and both proteins were separated from each other and from a protein encoded by blasticidin resistance gene (cloned from pQCXIB #631516, Clontech) by self-cleavage peptide P2A ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: For testing protein-protein interactions Matchmaker™ GAL4 Two-Hybrid System 3 was used according to the manufacturer’s instructions (Clontech). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.4) and the protein contents of the cell lysate were quantified using a BCA Protein Assay Kit (TAKARA, T9300A) following the manufacturer’s protocol (Song et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatants were collected and mixed with Laemmli buffer after measuring the protein concentration using a TaKaRa BCA Protein Assay Kit (TaKaRa). Samples were subjected to SDS-polyacrylamide gel electrophoresis and electrotransferred onto polyvinylidene difluoride membranes ...
-
bioRxiv - Genomics 2020Quote: ... CAS9 protein was purchased from Clontech (Cat # 632641). For injection ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using amylose-agarose resin (Clontech) and eluted in 10 mM maltose ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration was determined by Bradford assay (TAKARA). Nickel affinity purification of 10His-SUMO1T95R conjugates was carried out with Ni-NTA agarose beads (Qiagen) ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were bound to TALON IMAC resin (Clontech) overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purified using TALON resin (Takara Bio) using standard protocols in 50 mM phosphate buffer pH7.4 containing 300mM NaCl.
-
bioRxiv - Molecular Biology 2022Quote: ... The protein was purified by TALON affinity (Clontech), HiTrap-Q anion-exchange (Cytiva ...
-
bioRxiv - Microbiology 2022Quote: ... proteins were purified using Talon resin (Takara Bio) by resuspending the cell pellet in lysis buffer (50 mM phosphate buffer and 300 mM NaCl ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... Using a BCA protein kit (TaKaRa, Shiga, Japan), a working solution (BCA reagent A ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Neuroscience 2019Quote: ... and 96 hours post transfection viral particle containing supernatants were harvested and filtered through a 0.45μm PES syringe filter (Membrane Solutions, Cat. Nr. SFPES030045S) followed by a 6-fold concentration using Lenti-X-Concentrator (Clontech, Cat. Nr. 631232) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... PCR amplified using VR47F/R and cloned into KpnI and HindIII cut pOPINRSF using In-Fusion cloning (Takara Bio), resulting in pVR01 ...
-
bioRxiv - Microbiology 2023Quote: ... using Psme1Sal1-F/Psme1BamHI-R primer pairs (Table S4) and cloned as a Sal1/BamH1 fragment into pEGFPC1 (Clontech). For production of GST- and His6-Myc-fusion proteins ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Molecular Biology 2020Quote: AQ-seq (bias-minimized sRNA-seq) libraries were constructed using total RNAs from fifteen mouse tissues (Mouse Total RNA Master Panel; Takara) as described in our previous study (Kim et al. ...
-
bioRxiv - Genetics 2021Quote: 1:500 mouse anti-GFP (Takara, JL-8)
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP monoclonal JL8 (1:3000, Clontech), and mouse anti-α-tubulin monoclonal DM1A (1:3000 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-GFP (JL-8 clone, Takara Bio) or mouse anti-alpha-tubulin (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Molecular Biology 2019Quote: ... or a mouse α-GFP antibody (632381, Takara) to a dilution of 1:2000 in Odyssey Blocking Buffer (PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNAs from Mouse Total RNA Master Panel (Takara) were reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... we used the normalized mouse brain library (Clontech Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse GFP (1:4,000, Living Colors, 632380, Clontech) and rabbit β-Actin (1:3,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% normal donkey serum ...
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse anti-GFP (1:200; PA; Clontech). Alexa Fluor 488- ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Anti-GFP (1:1000; JL-8, Clontech). Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies: mouse antimCherry (Clontech, Cat. No. 632543), chicken antiGFP (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... and mouse anti-SPARC/Osteonectin (ON1-1, Takara) for 1 h at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... MSCs and chondrocytes were fluorescently labeled using mitochondrial or cytoplasm targeted lentiviruses driven by an EF1α promoter for co-cultures (Takara Bio USA, Inc.). Mitochondria were labeled with GFP or mCherry (0017VCT ...
-
bioRxiv - Cell Biology 2021Quote: ... a plasmid expressing enhanced green fluorescent protein (EGFP) (Clontech), or in another series of experiments with pVSV-G ...
-
bioRxiv - Biophysics 2020Quote: ... The protein was initially purified using Talon resin (Clontech) with a linear gradient of 50 to 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using TALON Metal Affinity Resin (Clontech) and dialyzed overnight against PBS buffer ...