Labshake search
Citations for Takara Bio :
201 - 250 of 843 citations for Recombinant Mouse Erbb2 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... the resulting Myc-tagged versions were then cloned into the BamHI site of pEGFP-N3 (Clontech Laboratories). Finally ...
-
bioRxiv - Pathology 2020Quote: ... RBD-scFv was purified from the supernatant using Capturem™ His-Tagged Purification Miniprep Kit (Takara Bio). One prep of 800 μL supernatant through one column of the kit yielded 102 μg/mL of RBD-scFv measured by NanoDrop™ 2000/2000c Spectrophotometers (ThermoFisher) ...
-
bioRxiv - Microbiology 2020Quote: N-terminally Strep TagII tagged ZIKV Capsid was cloned to pLVX-TetOne-Puro Vector (Clontech, Cat: 631849) using BamHI & EcoRI cut sites ...
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant plasmids were transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763), and positive colonies were selected on LB plates containing spectinomycin (100ug/mL ...
-
bioRxiv - Microbiology 2022Quote: ... The thrombin-digested recombinant NA was incubated with TALON metal affinity resin (Takara) for 2 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and homogenization (NIM2 buffer supplemented with Recombinant RNase Inhibitor (0.4 U/μL, Takara), SUPERase in (0.2 U/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant plasmid was transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763) according to the manufacturer’s protocol and positive colonies were selected on LB plates containing kanamycin (50 μg/mL).
-
bioRxiv - Pathology 2020Quote: ... followed by treatment with 10 U of recombinant DNase I (Cat.#2270A, TaKaRa) to remove residual DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... the MEFs were transduced using a replication defective recombinant retroviral expression system (Clontech) with either wild-type (Parl WT ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 0.1 U/μL of recombinant RNase inhibitor (wash buffer-RIn, Takara). Mechanical cell lysis was achieved by mixing each sample with 0.1 mm glass beads and grinding in a Retsch mixer mill at a frequency of 30/s for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was produced using an Adenovirus Dual Expression Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Extracted RNA (20µg) was treated with recombinant DNase I (RNAse free) (Takara, Japan) and then cleaned-up using RNeasy spin column (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... The extracted RNA was treated with Recombinant DNase I (2270A, Takara, Shiga, Japan), and 2 ng equivalent was synthesized using Super Script 3 Supermix (18080400 ...
-
bioRxiv - Immunology 2023Quote: ... tubes with 1:1 FBS:PBS supplemented with recombinant RNase inhibitor (1:100, Takara). The live singlet gated CD3+ T cells were further gated as per the gating strategy shown in additional file 1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A full-length Myc tagged cDNA expressing human NEK9 (NM_001329237.1) was subcloned into the pVLX-Tight-Puro vector (Clontech). The RCC1 domain was deleted using the Quickchange® II XL Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Stratagene ...
-
bioRxiv - Microbiology 2021Quote: ... the cells were transfected with eukaryotic expression plasmid harbouring FLAG or MYC-tagged FBXO22 using Xfect (TAKARA Bio) transfection reagent according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: EGFP-tagged rat PKCδ cDNA were cloned into EcoRI and BamHI digested pRetroX-TetOne-Puro (#634307, Takara Bio) using In-Fusion cloning system (#639648 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP and mCherry tagged cDNA constructs were cloned into pBMN and modified pLXIN (Clontech, Mountain View, CA, USA) retroviral expression vectors(Peden et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... cloned into HA vector using HA tagged hNHE6.2-FL as template and using in-fusion snap method (Takara, In-Fusion® Snap Assembly Master Mix ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... probes labeled with [α-32P] dCTP by random priming (Takara, cat# 6045) were hybridized to the membrane in PerfectHyb Plus Hybridization buffer (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Genomics 2021Quote: Hap1 cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM) supplemented with 10% FCS (Clontech), 1% Penicillin/Streptomycin (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Purification of recombinant Ply was performed using Talon resin (#PT1320-1, Clontech Laboratories Inc.) affinity chromatography from freshly transformed BL21/DE3 E ...
-
bioRxiv - Biochemistry 2020Quote: Standard recombinant DNA techniques and In-Fusion® HD Cloning (Takara Bio USA, Inc.) were used for plasmids construction in this study and were verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant lentivirus titer was measured using Lenti-XTM GoStixTM Plus (ClonTech, catalog number: 631280). E0771 and RM-1 cells were transduced with lentiviral vectors carrying the luciferase expression cassette with TransDux MAXTM (System Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... These recombinant plasmids were transformed into Escherichia coli BL21 (Takara Bio Co Ltd, Japan) and the transformed cells were cultured at 37°C until the OD600 reached at 0.6–0.8 ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant AAV9 vectors were generated by co-transfection of AAVpro 293T cells (Takara Bio) with three plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... N-terminal Flag-tagged P38α containing 3C protease site was amplified by PCR using CloneAmp HiFi PCR Premix (Takara) and ligated in to pcDNA3 using the aforementioned restrictions sites ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples containing the thereby secreted [His]6-tagged VHH-HlyA fusions were next passed through Talon CellThru resin (Clontech). For this ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Genetics 2022Quote: ... ISH was performed using digoxigenin-labeled oligonucleotide lnc-WAL probe (TCAGCACTGTCATCATTACATT) (Takara, Japan) according to previous literature(Liu et al. ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: The cDNAs for HA-tagged ELF3 were amplified from the KhES-1 cDNA library by PCR using PrimeSTAR GXL (Takara) and were subcloned into the pENTR/D entry vector (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: The FKBP sequence was tagged to a 3xFLAG-LRRK2 vector using IN-FUSION HD cloning technology (Clontech, Takara, cat #638920). LYSO-LRRK2 was created by adding the N terminal domain of the LAMTOR1 sequence (aa 1-39 ...
-
bioRxiv - Cell Biology 2021Quote: The FKBP sequence was tagged to a 3xFLAG-LRRK2 vector using IN-FUSION HD cloning technology (Clontech, Takara, cat #638920). LYSO-LRRK2 was created by adding the N terminal domain of the LAMTOR1 sequence (aa 1-39 ...
-
bioRxiv - Cancer Biology 2019Quote: ... This plasmid was used as a template to generate GFP-tagged mutant versions Cdc42ep5GPS-AAA using In-Fusion cloning (Takara). To allow for lentiviral infection and stable expression ...
-
bioRxiv - Cell Biology 2021Quote: ... WT TARPs and ncAA-tagged TARPs were subcloned into a bidirectional doxycycline-inducible expression vector pTRE3G-BI (Takara Bio, #631332) using the restriction sites KpnI/XbaI ...
-
bioRxiv - Microbiology 2019Quote: ... TetON-IRE1-GFP MEFs were obtained by reconstituting Ire1-/- MEFs with GFP-tagged murine IRE1 under control of a ‘tight’ Tet-responsive element (Clontech) essentially as described (Bakunts et al ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-002 encodes a C-terminal FLAG-tagged version of human PKR hosted in the retroviral expression vector pLPCX (Clontech) and was generated by cloning a PCR product (PCRP ...
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding C-terminally His-tagged Gtsf1 or Gtsf1L was amplified by PCR and cloned into pCold vector (Takara) by In-fusion cloning kit (Takara) ...
-
bioRxiv - Biochemistry 2023Quote: ... FL-human KANK1 (generous donation from the Bershadsky lab) cDNA was tagged in the C-terminal site with pmCherry (Clontech) by restriction digestion ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single embryos were collected in 2 µl RNase free water with Recombinant RNase inhibitor (TAKARA) and ruptured with an RNase free needle ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Neuroscience 2022Quote: ... with RNAse-free water with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A) and a fresh dilution of 1 in 300,000 was prepared before the first strand synthesis.
-
bioRxiv - Neuroscience 2022Quote: ... with RNAse-free water with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A) and a fresh dilution of 1 in 300,000 was prepared before the first strand synthesis.
-
bioRxiv - Microbiology 2024Quote: ... The recombinant construct was transformed into Escherichia coli StellarTM Competent Cells (dam–/dcm–) (Takara Bio) according to the supplier’s protocol (ClonTech ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...