Labshake search
Citations for Takara Bio :
351 - 400 of 3737 citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The cells were then treated with 2 μg/mL puromycin (Clontech; 631306) under selection for at least 1 week ...
-
bioRxiv - Cancer Biology 2023Quote: ... then cells were selected with 2 μg/ml puromycin (631306; Takara Bio) or 500 μg/ml geneticin (10131027 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid GFP-GT198 contained full-length human GT198 in a pEGFP-C3 vector (Clontech, 6082-1). HeLa cells transfected with GFP-GT198 (green ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Microbiology 2023Quote: HEp-2 cells were transduced with supernatants of Plat-GP cells cotransfected with pMDG60 and pRetroX-Tet3G (TaKaRa), selected with 4 mg/ml G418 (Wako) ...
-
bioRxiv - Immunology 2020Quote: Transferrin over-expression or knockdown vectors were constructed and HEK 293T cells (Conservation Genetics CAS Kunming Cell Bank, China) and EcoPack™ 2–293 cells (Clontech, USA) were used to package lentiviruses and retroviruses ...
-
bioRxiv - Microbiology 2022Quote: ... The thrombin-digested recombinant NA was incubated with TALON metal affinity resin (Takara) for 2 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and homogenization (NIM2 buffer supplemented with Recombinant RNase Inhibitor (0.4 U/μL, Takara), SUPERase in (0.2 U/μL ...
-
bioRxiv - Pathology 2020Quote: ... followed by treatment with 10 U of recombinant DNase I (Cat.#2270A, TaKaRa) to remove residual DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... the MEFs were transduced using a replication defective recombinant retroviral expression system (Clontech) with either wild-type (Parl WT ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 0.1 U/μL of recombinant RNase inhibitor (wash buffer-RIn, Takara). Mechanical cell lysis was achieved by mixing each sample with 0.1 mm glass beads and grinding in a Retsch mixer mill at a frequency of 30/s for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was produced using an Adenovirus Dual Expression Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Extracted RNA (20µg) was treated with recombinant DNase I (RNAse free) (Takara, Japan) and then cleaned-up using RNeasy spin column (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... The extracted RNA was treated with Recombinant DNase I (2270A, Takara, Shiga, Japan), and 2 ng equivalent was synthesized using Super Script 3 Supermix (18080400 ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Plant Biology 2020Quote: ... The E.coli-expressed tNPR1-His protein was extracted and purified using TALON Metal Affinity Resin (Clontech). For rabbit immunization ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases ...
-
bioRxiv - Molecular Biology 2019Quote: ... the fragment were ligated into the Xho I and Bam HI sites of pEGFP-N3 (Clontech), creating Aβ fused in frame to the N-terminus of GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... pAcGFP-His-MAP2C without AcGFP was amplified and Dendra2 was amplified from pDendra2-C vector (Takara). Dendra2 was inserted into where AcGFP was by In-Fusion cloning kit ...
-
bioRxiv - Neuroscience 2023Quote: EGFP-tagged rat PKCδ cDNA were cloned into EcoRI and BamHI digested pRetroX-TetOne-Puro (#634307, Takara Bio) using In-Fusion cloning system (#639648 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP and mCherry tagged cDNA constructs were cloned into pBMN and modified pLXIN (Clontech, Mountain View, CA, USA) retroviral expression vectors(Peden et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... cloned into HA vector using HA tagged hNHE6.2-FL as template and using in-fusion snap method (Takara, In-Fusion® Snap Assembly Master Mix ...
-
bioRxiv - Genomics 2019Quote: ... Retroviruses were packed using the EcoPack 2-293 cells (Clontech, Mountain View, CA) and infections were performed as described12 ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Biochemistry 2020Quote: Standard recombinant DNA techniques and In-Fusion® HD Cloning (Takara Bio USA, Inc.) were used for plasmids construction in this study and were verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant lentivirus titer was measured using Lenti-XTM GoStixTM Plus (ClonTech, catalog number: 631280). E0771 and RM-1 cells were transduced with lentiviral vectors carrying the luciferase expression cassette with TransDux MAXTM (System Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... These recombinant plasmids were transformed into Escherichia coli BL21 (Takara Bio Co Ltd, Japan) and the transformed cells were cultured at 37°C until the OD600 reached at 0.6–0.8 ...
-
bioRxiv - Biophysics 2022Quote: Experiments were performed using PtK2 GFP-α-tubulin cells (stable line expressing human α-tubulin in pEGFP-C1, Clontech Laboratories ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were produced by transient transfection of human epithelium kidney 293T Lenti-X cells (Clontech Laboratories, Mountain View, CA) using the JetPrime transfection kit (Polyplus Transfection Illkirch ...
-
bioRxiv - Cell Biology 2021Quote: ... US) and human cervical adenocarcinoma cells expressing a tetracycline-inducible repressor (HeLa Tet-Off, Clontech, Mountain View, California, US) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Individual lentiCRISPRv2 vectors were introduced along with packaging vectors into human embryonic kidney (HEK) 293T cells via calcium phosphate transfection according to the manufacturer’s protocol (Clontech). Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology) ...
-
bioRxiv - Biochemistry 2022Quote: ... N-terminal Flag-tagged P38α containing 3C protease site was amplified by PCR using CloneAmp HiFi PCR Premix (Takara) and ligated in to pcDNA3 using the aforementioned restrictions sites ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of 6X-Histidine tagged cavin proteins was done using TALON metal affinity resin (ClonTech, Scientifix Cat No. 635503). Talon resin was thoroughly washed with 500GF buffer containing 5 mM imidazole to remove detergent and non-specifically bound proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Aer01 tagged with dTomato were labeled by incubating larvae in blocking solution containing Rabbit anti-dsRed (Takara Bio #6324960) at 1:500 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Plant Biology 2019Quote: Each purified protein preparation of His-PHOT1 N2 and N4 was incubated with TALON Magnetic Beads (TaKaRa) at 4°C for 30 min and further incubated at 4°C for 30 min with in vitro transcription and translation reactant containing RPT2 N ...
-
bioRxiv - Cell Biology 2022Quote: ... The library was generated by using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Clontech) with 1 μg RNA as input ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech) supplemented with 40mg/LX-α-gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside ...
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...