Labshake search
Citations for Takara Bio :
1 - 50 of 585 citations for Recombinant Human Metadherin GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... GST-tagged protein was eluted with 6ml glutathione (10mg/ml, Takara) and the flow-through was collected ...
-
bioRxiv - Cell Biology 2023Quote: ... for GST-tagged protein or on TALON-Cobalt beads column (635507, Takara Bio) for 6XHIS-tagged protein as previously described [19,26] ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids encoding GST-BVR (GST-BVRα) and GST-BVRβ were generated by cloning cDNA of human BLVRA and BLVRB into pCMV-GST vector (Clontech/TaKaRa). The construct encoding myc-FAK was generated as previously described (95) ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids encoding GST-BVR (GST-BVRα) and GST-BVRβ were generated by cloning cDNA of human BLVRA and BLVRB into pCMV-GST vector (Clontech/TaKaRa). The construct encoding myc-FAK was generated as previously described (95) ...
-
bioRxiv - Cell Biology 2020Quote: ... EGFP-tagged human β-actin (Clontech, Mountain View, CA, USA) was used ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2024Quote: ... DLK and DRP1 were N-terminally tagged into a GST-containing backbone using In-fusion cloning (Takara Bio. 638945). Cyto-mAPPLE plasmid was a gift from Michael E ...
-
bioRxiv - Neuroscience 2023Quote: Human MAP2C cDNA tagged with 6xHis was inserted into pAcGFP (Takara) vector using In- Fusion cloning kit (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... His-tagged PE11 recombinant protein was purified using Ni-NTA metal affinity resin (Clontech Laboratories, USA) in denaturing conditions using 8 M urea (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... RetroNectin® Recombinant Human Fibronectin Fragment (Takara Bio, Cat#T100A), Recombinant Murine Flt3-Ligand (Peprotech ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c) (Clontech), and HA-tagged hamster SCAP ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP-tagged human tauKQ and tauP301L were expressed from the pEGFP-C1 plasmid (Clontech). Expression of mApple or GFP in cultured neurons was done using pGW1 mApple and pEGFP-C1 plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... lysed by sonication and the recombinant His-tagged protein purified from cell-free extracts using IMAC (Talon resin, Clontech) as previously described19.
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilised metal affinity chromatography (IMAC using Talon resin; Clontech) as described previously (34) ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs for C-terminal GFP-tagged human RHBDL4 were generated by subcloning into pEGFP-N1 (Clontech). For generating point mutants ...
-
bioRxiv - Plant Biology 2023Quote: ... His8-tagged soluble or insoluble CML recombinant proteins were purified at room temperature using Ni-NTA resin (His60, Takara Bio Inc.) using the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Cell Biology 2024Quote: ... GST and GST-fused proteins were transfected into the cells using Xfect™ Protein Transfection Reagent (TaKaRa, 631324) following the manufacturer’s instruction.
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-002 encodes a C-terminal FLAG-tagged version of human PKR hosted in the retroviral expression vector pLPCX (Clontech) and was generated by cloning a PCR product (PCRP ...
-
bioRxiv - Biochemistry 2023Quote: ... FL-human KANK1 (generous donation from the Bershadsky lab) cDNA was tagged in the C-terminal site with pmCherry (Clontech) by restriction digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... GST tags were cleaved by HRV-3C Protease (Takara), which released the recombinant proteins from the beads ...
-
bioRxiv - Systems Biology 2023Quote: ... Recombinant DNase I (TaKaRa) was used to digest DNAs ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... EGFP tagged construct was generated in pEGFP-N1 (Clontech).
-
bioRxiv - Immunology 2021Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Recombinant RNase Inhibitor (Takara, Japan) were added into the cell pellets ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant Ribonuclease Inhibitor (Takara), and 10 U/μL Enzscript Moloney-Murine Leukemia Virus Reverse Transcriptase (Enzymatics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged CD45RO was purified by TALON affinity resin (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... sfGFP-tagged proteins were visualized with monoclonal anti-GFP (Takara). Anti-Sty1 polyclonal antibody (Jara et al ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP tagged Pol η was expressed from pEGFP-C1 (Clontech), that we firstly modified by addition of an SV40 nuclear localization signal (ATGCCAAAGAAGAAGCGAAAGGTA GCAGATCCA ...
-
bioRxiv - Biochemistry 2022Quote: ... to encode a 3C-cleavable His6-GST-fusion using In-Fusion enzyme (Clontech, Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... to encode a 3C-cleavable His6-GST-fusion using In-Fusion enzyme (Clontech, Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... His-tagged Cbln1 were purified by Talon metal affinity resin (Clontech) and dialyzed against HBSS ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified with Capturem™ His-Tagged Purification Maxiprep Kit (Takara). The binding reaction was performed in 20 μL binding buffer (10 mM Tris pH 8.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... His6-tagged proteins were purified with Talon metal affinity resin (Clontech) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 160 μl recombinant RNase inhibitor (Takara Clonetech), 1.6 ml of 10 mM dNTP (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... and treated with recombinant DNase I (Takara). The treated RNA was purified with an RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... 160 µL recombinant RNase inhibitor (Takara Clonetech), 1.6 mL of 10 mM dNTP (ThermoFisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.2U/ml Recombinant ribonuclease inhibitor (Takara, #2313B). A second centrifugation (same conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.025 μL recombinant RNase inhibitor (Takara, 2313B), 0.04 μL reverse transcriptase (Thermo Fisher Scientific ...