Labshake search
Citations for Takara Bio :
151 - 200 of 968 citations for Recombinant Human Lectin Galactoside Binding Soluble 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The extracted RNA was treated with Recombinant DNase I (2270A, Takara, Shiga, Japan), and 2 ng equivalent was synthesized using Super Script 3 Supermix (18080400 ...
-
bioRxiv - Immunology 2023Quote: ... tubes with 1:1 FBS:PBS supplemented with recombinant RNase inhibitor (1:100, Takara). The live singlet gated CD3+ T cells were further gated as per the gating strategy shown in additional file 1 ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP.
-
bioRxiv - Genetics 2021Quote: The coding sequence of the MAR was inserted into the Gal4 DNA-binding domain vector pGBKT7 (Clontech); the coding sequences for full length Nup60 and Nup60(188-388 ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Microbiology 2020Quote: ... Purification of recombinant Ply was performed using Talon resin (#PT1320-1, Clontech Laboratories Inc.) affinity chromatography from freshly transformed BL21/DE3 E ...
-
bioRxiv - Biochemistry 2020Quote: Standard recombinant DNA techniques and In-Fusion® HD Cloning (Takara Bio USA, Inc.) were used for plasmids construction in this study and were verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant lentivirus titer was measured using Lenti-XTM GoStixTM Plus (ClonTech, catalog number: 631280). E0771 and RM-1 cells were transduced with lentiviral vectors carrying the luciferase expression cassette with TransDux MAXTM (System Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... These recombinant plasmids were transformed into Escherichia coli BL21 (Takara Bio Co Ltd, Japan) and the transformed cells were cultured at 37°C until the OD600 reached at 0.6–0.8 ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant AAV9 vectors were generated by co-transfection of AAVpro 293T cells (Takara Bio) with three plasmids ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Biochemistry 2022Quote: ... and mixed with 50 μL TALON Co2+ resin pre-equilibrated in binding buffer A (Takara Bio, 50% slurry) resulting in a final volume of 100 μL ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single embryos were collected in 2 µl RNase free water with Recombinant RNase inhibitor (TAKARA) and ruptured with an RNase free needle ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant protein was purified using the His60 Ni gravity column purification kit (Takara Bio) according to the manual instruction ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant proteins of interest were bound to TALON metal affinity beads (Clontech, Mountain View, CA) and eluted with imidazole (gradient 10–200 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... with RNAse-free water with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A) and a fresh dilution of 1 in 300,000 was prepared before the first strand synthesis.
-
bioRxiv - Neuroscience 2022Quote: ... with RNAse-free water with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A) and a fresh dilution of 1 in 300,000 was prepared before the first strand synthesis.
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified from Escherichia coli BL21 (DE3) with TALON Metal Affinity Resin (Takara), Pierce Glutathione Agarose (Thermo scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... The recombinant construct was transformed into Escherichia coli StellarTM Competent Cells (dam–/dcm–) (Takara Bio) according to the supplier’s protocol (ClonTech ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Neuroscience 2021Quote: Human Brain Total RNA (Takara Cat. #636530) and Human Brain Cerebral Cortex Total RNA (Takara Cat ...
-
bioRxiv - Microbiology 2019Quote: Human fetal NSCs were purchased from Clontech (human neural cortex ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney (HEK293T) cells (632180; Takara) were cultured in DMEM (10-013-CV ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney epithelial Lenti-X293T (Clontech) cells were cultured in complete DMEM (Sigma Aldrich ...
-
Replication Timing and Transcription Identifies a Novel Fragility Signature Under Replication StressbioRxiv - Genetics 2019Quote: Human foreskin fibroblasts BJ-hTERT cells (Clontech) were grown in DMEM supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Human cardiomyocyte cells were purchased from Takara Bio (ref Y10060) ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... the full-length ORF of PpGL2 fused with the GAL4 DNA binding domain in the PGBKT7 vector (Clontech, Japan) was transformed into the competent yeast strain Y2HGold ...
-
bioRxiv - Biophysics 2019Quote: A cDNA encoding human DBNL was amplified by PCR from Human Brain Whole QUICK-Clone™ cDNA (Clontech Laboratories) using the primers ...
-
bioRxiv - Genomics 2021Quote: U2OS (human bone osteosarcoma epithelial, female, ATCC HTB-96) and LentiX 293T (human embroyonic kidney epithelial, female, Takara 632180) cells were cultured in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and 3× PrimeScript enzyme mix (TAKARA) were added to the purified nucleic acids for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: Then 3 uL of MNase (Takara) was added to each sample and the incubation lasted for 15min at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3 μl of lysis buffer (0.13% Triton-X-100, 4 units of recombinant RNase Inhibitor, Takara) was added to 3.7 μl of cell-free CSF and plasma ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The recombinant Irg1-like protein was enriched using cobalt TALON Metal Affinity Resin (Takara Bio #635501) with gentle shaking for 1 hour at 4 ℃ and washed twice by centrifugation for 3 minutes at 3500 rpm at 4 ℃ and resuspension in the washing buffer (20 mM Tris pH 8.0 ...