Labshake search
Citations for Takara Bio :
201 - 250 of 1200 citations for Recombinant Human Interleukin 2 Receptor Alpha His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Purification of the His6-tagged protein was achieved by TALON® spin columns (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Total RNA was treated with Recombinant DNase I (RNase-free) (Takara) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.8 μL of Guide-it Recombinant Cas9 (10 μg/μL, Takara) was added to the above PCR tube with the prepared sgRNA and incubated at 37°C for 5 min to assemble the ribonucleotide protein (RNP ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4.5 µl of recombinant ribonuclease (RNase) inhibitor (2313A,Takara Bio). The tissue was homogenized in tissue grinder (D9063 ...
-
bioRxiv - Neuroscience 2023Quote: ... Insoluble material was removed by centrifugation and the supernatant containing the receptor was rotated with Talon resin (Takara) overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... HIS-Ub-conjugated proteins were purified by cobalt chromatography (TALON metal affinity resin, Clontech), as described in the manual ...
-
bioRxiv - Plant Biology 2021Quote: ... SD growth medium w/o Ade−His−Leu−Trp− (Himedia) and supplements media (Clontech) were used for the Y2H experiment.
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: ... and then grown on SD-Trp-Leu and SD-Trp-Leu-His plates (Clontech).
-
bioRxiv - Biochemistry 2023Quote: ... EPHA2- FN2 and antigen-A were purified using His 60 Ni Superflow resin (Takara), whilst antigen-B was purified with rProteinA Sepharose (GE Healthcare) ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a permanent C-terminal His-tag were purified using TALON (Clontech) resin followed by anion exchange using a Hitrap Q column (Cytiva) ...
-
bioRxiv - Cell Biology 2019Quote: GFP-tagged SAF-A alleles were cloned into the lentiviral expression vector pLVX-TetOne-puro (Takara) using In-Fusion cloning ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM DTT and 400 units/ml of Recombinant RNase Inhibitor (TaKaRa)) with cOmplete (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: The extracted RNA was treated with Recombinant DNase I (Takara Bio, Japan) to digest the remaining genomic DNA and was purified by phenol/chloroform/isoamyl alcohol (25:24:21 ...
-
bioRxiv - Microbiology 2020Quote: ... Purification tags were removed by treating recombinant proteins with HRV3C protease (TaKaRa) and cOmplete™ His-tag Purification Resin (Roche) ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant DmNobo was expressed with the pCold-III plasmid vector (TaKaRa Bio) in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant plasmids were co-transformed into yeast Y2H Gold strain (Takara). The transformed yeast strains were grown on DDO (SD/-Leu/-Trp ...
-
bioRxiv - Immunology 2023Quote: The recombinant Lenti-X™ pLVX-IRES lentiviral vector expression system (TakaRa) was used to introduce Wuhan-Hu-1 ...
-
bioRxiv - Microbiology 2023Quote: ... Free DNA was removed via DNase treatment (Recombinant DNase I; Takara, Japan). Viral DNA was extracted using the DNeasy Blood & Tissue Kits (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... 0.1mM EDTA) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B). Nuclei were counted and kept on ice (or for longer storage at - 80°C) ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant CML13 and CML14 were purified via Ni-NTA His60 (Takara Biosciences.) and CaM7 using phenyl-sepharose (Sigma Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant cholix toxin was first purified on nickel metal affinity chromatography (Takara) and subsequent TEV protease-mediated 6His-MBP tag removal at 4°C/Over Night (ON) ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Molecular Biology 2020Quote: ... Both soluble and insoluble (cell pellet) fractions were purified via His-IDA nickel column (Clontech Laboratories ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the SMARTer Stranded Total RNA HI Mammalian kit (Takara 634873) with 0.5-1ug of RNA and samples were sequenced on the NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...
-
bioRxiv - Plant Biology 2023Quote: ... The yeast transformants were grown on nutrient-restricted (without Trp, Leu, His, Ade) mediums (Clontech) 3-5 days to assess interactions between various protein combinations.
-
bioRxiv - Biophysics 2023Quote: WT and R203M N175-245were purified using the TALON His-tag purification protocol (Clontech Laboratories). Cell pellets were lysed in high salt buffer (50 mM tris ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Tissues expressing mCherry-tagged Yellow protein (ymCherry) were stained with rabbit anti-dsRed (Clontech 632496, 1:1000) and rat anti-DN-Cadherin (DN-Ex #8 ...
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...
-
bioRxiv - Biophysics 2019Quote: ... The mEos3.2 tagged constructs used here are in Clontech N1 plasmid vector background (Clontech, Mountain View, CA).
-
bioRxiv - Cell Biology 2022Quote: ... the resulting Myc-tagged versions were then cloned into the BamHI site of pEGFP-N3 (Clontech Laboratories). Finally ...
-
bioRxiv - Microbiology 2020Quote: N-terminally Strep TagII tagged ZIKV Capsid was cloned to pLVX-TetOne-Puro Vector (Clontech, Cat: 631849) using BamHI & EcoRI cut sites ...
-
bioRxiv - Immunology 2020Quote: ... The entirety of each of the annotated intracellular domains was ordered as a separate gene fragment (Integrated DNA Technologies) and each complete receptor was cloned into pHR lentiviral expression vector (Clontech). Each region of the protein was amplified using PCR and fragments were combined using Gibson assembly.
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant plasmids were transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763), and positive colonies were selected on LB plates containing spectinomycin (100ug/mL ...
-
bioRxiv - Microbiology 2022Quote: ... The thrombin-digested recombinant NA was incubated with TALON metal affinity resin (Takara) for 2 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and homogenization (NIM2 buffer supplemented with Recombinant RNase Inhibitor (0.4 U/μL, Takara), SUPERase in (0.2 U/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant plasmid was transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763) according to the manufacturer’s protocol and positive colonies were selected on LB plates containing kanamycin (50 μg/mL).
-
bioRxiv - Pathology 2020Quote: ... followed by treatment with 10 U of recombinant DNase I (Cat.#2270A, TaKaRa) to remove residual DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... the MEFs were transduced using a replication defective recombinant retroviral expression system (Clontech) with either wild-type (Parl WT ...