Labshake search
Citations for Takara Bio :
51 - 100 of 732 citations for Recombinant Human Histidine rich Glycoprotein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630428, Clontech) or –Trp ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630419, Clontech) selective media +3 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (Clontech) with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR polymerase capable of handling GC-rich amplicons was used (PrimeSTAR GXL Premix, Clontech). The resulting DNA amplicon ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-002 encodes a C-terminal FLAG-tagged version of human PKR hosted in the retroviral expression vector pLPCX (Clontech) and was generated by cloning a PCR product (PCRP ...
-
bioRxiv - Biochemistry 2023Quote: ... FL-human KANK1 (generous donation from the Bershadsky lab) cDNA was tagged in the C-terminal site with pmCherry (Clontech) by restriction digestion ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-His (Clontech 631212), anti-H3K36me2 (Upstate 07-369) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Neuroscience 2020Quote: ... the hexa-histidine tag was replaced with a SnapTag by In-Fusion cloning (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... the hexa-histidine tag was replaced with a SnapTag by In-Fusion cloning (Takara Bio). pCI-SEP-NRI was a gift from Robert Malinow (Addgene plasmid # 23999 ...
-
bioRxiv - Microbiology 2020Quote: ... to remove cellular debris and the protein was column-purified using anti-histidine resin (ClonTech). The resin was washed ten times with 10x column volumes of wash buffer mixed with an increasing proportion of tris buffer (20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... Two-hybrid interaction was tested with YNB medium lacking histidine in Saccharomyces cerevisiae strain AH109 (Clontech).
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Immunology 2024Quote: ... genes encoding the variable regions of C7 and C74 heavy chains were cloned into a pMN vector with a human CH1 domain and a C-terminal His-tag using In-Fusion cloning system (Takara Bio #639649). The full light chains of C7 and C74 were cloned into the pMN vector without any purification tag using the same method ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Plant Biology 2023Quote: ... histidine and adenine (-LTHA) as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To overcome auto-activation from some of the constructs ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant RNase inhibitor (Takara) and protease inhibitor cocktail (Sigma-Aldrich)) ...
-
bioRxiv - Systems Biology 2023Quote: ... Recombinant DNase I (TaKaRa) was used to digest DNAs ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Bioengineering 2019Quote: ... SD-His or SD-Trp-Ura (Clontech). Mycoplasma pneumoniae strain M129 (ATCC 29342) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Immunology 2019Quote: ... 1.85U recombinant RNase Inhibitor (Takara), 1.85 μM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Biophysics 2022Quote: ... with insertion of N-terminal residues MATLEK a part of the N17 domain and C-terminal residues PQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRP which comprise the PR (proline-rich) domain containing the C38 domain using primers as a part of In-Fusion cloning protocol (Takara). eGFP-PolyQ31 was adapted from eGFP-PolyQ74 through the variability of Q-length PCR products amplified using CloneAmp HiFi PCR Premix (Takara) ...
-
bioRxiv - Microbiology 2021Quote: ... EGFP tagged construct was generated in pEGFP-N1 (Clontech).
-
LptM promotes oxidative maturation of the lipopolysaccharide translocon by substrate binding mimicrybioRxiv - Microbiology 2023Quote: ... membranes were incubated with epitope-specific rabbit polyclonal antisera or with an anti poly-histidine horseradish peroxidase-conjugated monoclonal antibody (TaKaRa). Immunodetection was revealed by using a Clarity Western ECL blotting substrate (BioRad ...
-
bioRxiv - Microbiology 2019Quote: ... and loaded on His 60 Ni resin (TAKARA) after equilibrating ...
-
bioRxiv - Microbiology 2022Quote: ... Western blots using Anti-His primary antibody (Clontech) (1:4000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2019Quote: ... Clarified lysates were incubated with HIS-60 (Takara) resin for 30-60 minutes ...
-
bioRxiv - Immunology 2021Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Biochemistry 2019Quote: ... and Recombinant RNAse i nhibitor (TaKaRa). cDNA was prepared from total RNAs using ReverTra Ace (TOYOBO) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Recombinant RNase Inhibitor (Takara, Japan) were added into the cell pellets ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant Ribonuclease Inhibitor (Takara), and 10 U/μL Enzscript Moloney-Murine Leukemia Virus Reverse Transcriptase (Enzymatics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...