Labshake search
Citations for Takara Bio :
201 - 250 of 733 citations for Recombinant Human H1 Histone Family Member 0 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... EPHA2- FN2 and antigen-A were purified using His 60 Ni Superflow resin (Takara), whilst antigen-B was purified with rProteinA Sepharose (GE Healthcare) ...
-
bioRxiv - Cell Biology 2019Quote: GFP-tagged SAF-A alleles were cloned into the lentiviral expression vector pLVX-TetOne-puro (Takara) using In-Fusion cloning ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM DTT and 400 units/ml of Recombinant RNase Inhibitor (TaKaRa)) with cOmplete (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: The extracted RNA was treated with Recombinant DNase I (Takara Bio, Japan) to digest the remaining genomic DNA and was purified by phenol/chloroform/isoamyl alcohol (25:24:21 ...
-
bioRxiv - Microbiology 2020Quote: ... Purification tags were removed by treating recombinant proteins with HRV3C protease (TaKaRa) and cOmplete™ His-tag Purification Resin (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 mM dNTP and 2 U/mL of recombinant RNase inhibitor (Clontech) then spun down and frozen at −80°C ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant DmNobo was expressed with the pCold-III plasmid vector (TaKaRa Bio) in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... Free DNA was removed via DNase treatment (Recombinant DNase I; Takara, Japan). Viral DNA was extracted using the DNeasy Blood & Tissue Kits (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant plasmids were co-transformed into yeast Y2H Gold strain (Takara). The transformed yeast strains were grown on DDO (SD/-Leu/-Trp ...
-
bioRxiv - Immunology 2023Quote: The recombinant Lenti-X™ pLVX-IRES lentiviral vector expression system (TakaRa) was used to introduce Wuhan-Hu-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at-80°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant CML13 and CML14 were purified via Ni-NTA His60 (Takara Biosciences.) and CaM7 using phenyl-sepharose (Sigma Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... 0.1mM EDTA) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B). Nuclei were counted and kept on ice (or for longer storage at - 80°C) ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant cholix toxin was first purified on nickel metal affinity chromatography (Takara) and subsequent TEV protease-mediated 6His-MBP tag removal at 4°C/Over Night (ON) ...
-
bioRxiv - Plant Biology 2020Quote: ... the promoter region of GELP38pro was PCR-amplified from Col-0 genomic DNA and cloned into linearized p1R4-ML:XVE (Siligato et al., 2016) with KpnI enzyme by Infusion (Takara) cloning to produce the inducible GELP38proXVE promoter clone ...
-
bioRxiv - Plant Biology 2023Quote: ... and selected on DDO (Synthetic Dropout Medium/-Tryptophan-Leucine) and TDO (Synthetic Dropout Medium/-Tryptophan-Histone-Leucine) media (Clontech) with corresponding concentration of 3-AT ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Molecular Biology 2020Quote: ... Both soluble and insoluble (cell pellet) fractions were purified via His-IDA nickel column (Clontech Laboratories ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the SMARTer Stranded Total RNA HI Mammalian kit (Takara 634873) with 0.5-1ug of RNA and samples were sequenced on the NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...
-
bioRxiv - Biophysics 2023Quote: WT and R203M N175-245were purified using the TALON His-tag purification protocol (Clontech Laboratories). Cell pellets were lysed in high salt buffer (50 mM tris ...
-
bioRxiv - Plant Biology 2023Quote: ... The yeast transformants were grown on nutrient-restricted (without Trp, Leu, His, Ade) mediums (Clontech) 3-5 days to assess interactions between various protein combinations.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Tissues expressing mCherry-tagged Yellow protein (ymCherry) were stained with rabbit anti-dsRed (Clontech 632496, 1:1000) and rat anti-DN-Cadherin (DN-Ex #8 ...
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...
-
bioRxiv - Biophysics 2019Quote: ... The mEos3.2 tagged constructs used here are in Clontech N1 plasmid vector background (Clontech, Mountain View, CA).
-
bioRxiv - Cell Biology 2022Quote: ... the resulting Myc-tagged versions were then cloned into the BamHI site of pEGFP-N3 (Clontech Laboratories). Finally ...
-
bioRxiv - Microbiology 2020Quote: N-terminally Strep TagII tagged ZIKV Capsid was cloned to pLVX-TetOne-Puro Vector (Clontech, Cat: 631849) using BamHI & EcoRI cut sites ...
-
bioRxiv - Cell Biology 2021Quote: ... pLL5.0-EGFP-HRasC20 was generated by insertion of EGFP-HRasC20 fragment which was amplified from pEGFP-F (#6074-1; Clontech) by PCR into pLL5.0 vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... Aliquots of 2.0 ug of the total RNA were collected for cDNA synthesis by using Clontech Oligo dT cDNA synthesis kit (Takara Bio USA ...
-
bioRxiv - Plant Biology 2023Quote: ... A genomic fragment containing the promotor region and full-length coding region of ATPC1 (At4g04640) was amplified from Col-0 genomic DNA by PCR using PrimeSTAR DNA polymerase (TaKaRa) and the primers ATPC1_F (CACCCATGGAGAGGGCTCGTACCTTAC ...
-
bioRxiv - Plant Biology 2024Quote: ... the VRN5 genomic region including endogenous promoter and terminator were amplified from genomic Col-0 DNA and cloned into pENTR using In-Fusion cloning (Takara). SYFP2 was then inserted with In-Fusion cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... and varying amounts (0, 10, 20, 100, 200 ng) of pAAV MyoD expression vectors into AAVpro 293T cells (Takara Bio) using the FuGENE HD transfection reagent (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant plasmids were transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763), and positive colonies were selected on LB plates containing spectinomycin (100ug/mL ...
-
bioRxiv - Microbiology 2022Quote: ... The thrombin-digested recombinant NA was incubated with TALON metal affinity resin (Takara) for 2 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and homogenization (NIM2 buffer supplemented with Recombinant RNase Inhibitor (0.4 U/μL, Takara), SUPERase in (0.2 U/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant plasmid was transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763) according to the manufacturer’s protocol and positive colonies were selected on LB plates containing kanamycin (50 μg/mL).
-
bioRxiv - Pathology 2020Quote: ... followed by treatment with 10 U of recombinant DNase I (Cat.#2270A, TaKaRa) to remove residual DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... the MEFs were transduced using a replication defective recombinant retroviral expression system (Clontech) with either wild-type (Parl WT ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 0.1 U/μL of recombinant RNase inhibitor (wash buffer-RIn, Takara). Mechanical cell lysis was achieved by mixing each sample with 0.1 mm glass beads and grinding in a Retsch mixer mill at a frequency of 30/s for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was produced using an Adenovirus Dual Expression Kit (Takara Bio) in accordance with the manufacturer’s protocol ...