Labshake search
Citations for Takara Bio :
501 - 550 of 890 citations for Recombinant Human ERBB2 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The protein was purified by TALON affinity (Clontech), HiTrap-Q anion-exchange (Cytiva ...
-
bioRxiv - Microbiology 2022Quote: ... proteins were purified using Talon resin (Takara Bio) by resuspending the cell pellet in lysis buffer (50 mM phosphate buffer and 300 mM NaCl ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... Using a BCA protein kit (TaKaRa, Shiga, Japan), a working solution (BCA reagent A ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Cell Biology 2020Quote: The commercially available Cellartis Human iPS Cell Line 12 (Takara Bio Inc., Kusatsu, Japan) was used as the human iPS Cell line ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA from the human brain (#636530) and testis (#636533) was purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... was generated by PCR amplification of human S1R gene (www.ncbi.nlm.nih.gov/nuccore/NM_005866.3) and cloning into pEGFP-N2 vector (Clontech) using HindIII/XbaI cloning sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Transplanted hiOLs were identified using anti-human cytoplasm (STEM121; Takara, Y40410, IgG1, 1:100), anti-human nuclei (STEM101 ...
-
bioRxiv - Cell Biology 2021Quote: ... The human fimbrin sequence was cloned into a pEGFP-C1 plasmid (Clontech; 6084-1). The human ezrin sequence was cloned into a pEGFP-N1 (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... The HB-EGF cDNA was obtained from the Human Brain Matchmaker cDNA library (Clontech). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... HEC1 and BUBR1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B55α was PCR amplified from HUVEC cDNA and cloned into pEGFP-C1 (Clontech) using HindIII and BamHI sites ...
-
bioRxiv - Biophysics 2022Quote: ... and human CaMKIIK42RD135N with a C-terminal AviTag were cloned into pEGFP-N1 (Clontech) vector ...
-
bioRxiv - Biophysics 2022Quote: The coding sequence of human PAC (NP_060722) previously subcloned into pIRES2-EGFP vector (Clontech) using XhoI and EcoRI restriction enzyme sites9 was used for whole-cell patch clamp recording ...
-
bioRxiv - Immunology 2023Quote: Immunocult-stimulated human CD3+ T cells were retrovirally transduced on Retronectin-coated plates (TaKaRa). 500 µL of cells per well at 0.5 × 106 cells/mL were supplemented with 0.5 mL retroviral supernatant and centrifuged for 90 minutes at 900 g at 32°C ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Cancer Biology 2023Quote: Human DHRS7 was expressed as a GFP fusion using the pEGFP-N2 vector (Clontech) generated previously [5] ...
-
bioRxiv - Synthetic Biology 2023Quote: Human Embryonic Kidney (HEK) 293 cells (ATCC, CRL-1573) and HEK293T-LentiX (Takara Biosciences) were cultured in standard culture conditions (37ºC and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human CXCR4 was cloned into the pAcGFPm-N1 plasmid (Clontech Laboratories, Palo Alto, CA), as described (20).
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney cells (Lenti-X 293T Cell line from Takara. Cat no. 632180) were grown in DMEM/F12 media (GIBCO ...
-
bioRxiv - Molecular Biology 2024Quote: The human embryonic kidney (HEK) 293T cell line was purchased from Takara (Cat# 632180) and cultured in a humidified 95% air / 5% CO2 incubator at 37°C in a standard Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Bioengineering 2024Quote: ... MSCs and chondrocytes were fluorescently labeled using mitochondrial or cytoplasm targeted lentiviruses driven by an EF1α promoter for co-cultures (Takara Bio USA, Inc.). Mitochondria were labeled with GFP or mCherry (0017VCT ...
-
bioRxiv - Cell Biology 2021Quote: ... a plasmid expressing enhanced green fluorescent protein (EGFP) (Clontech), or in another series of experiments with pVSV-G ...
-
bioRxiv - Biophysics 2020Quote: ... The protein was initially purified using Talon resin (Clontech) with a linear gradient of 50 to 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using TALON Metal Affinity Resin (Clontech) and dialyzed overnight against PBS buffer ...
-
bioRxiv - Immunology 2020Quote: ... The protein concentration was determined by Bradford assay (Takara), and the cell lysate was mixed with 4x Laemmli loading buffer containing β mercapto-ethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... Bound proteins were detected using Hyper HRP Substrate (Takara). PtIns(3,5)P2 Grip protein (P-3516-3-EC ...
-
bioRxiv - Biochemistry 2023Quote: ... The Bradford protein assay kit was purchased from Takara Bio (Shiga ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Proteins were bound to TALON SuperFlow IMAC resin (Takara) overnight ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Duke University Medical Center) and HeLa Tet-Off (HTO; human, female, cervix; Clontech, RRID: CVCL_V352) cells were cultured in high-glucose ...
-
bioRxiv - Neuroscience 2021Quote: ... The WT hPNPO cDNA was amplified from the human brain cDNA library (TaKaRa, Cat #637242) [24] ...
-
bioRxiv - Developmental Biology 2021Quote: ... cryosectioned brains were stained to detect expression of human cytoplasmic marker STEM121 (TaKaRa, cat. Y40410) and human-specific GFAP marker STEM123 (TaKaRa ...
-
bioRxiv - Biochemistry 2020Quote: Human embryonic kidney 293T cells (‘293T’) and Lenti-X 293T cells were purchased from Clontech/Takara Bio (Mountain View ...
-
bioRxiv - Cell Biology 2020Quote: ... CHO-K1 cells were transfected with ACP-human IR plasmid using Xfect transfection reagent (Takara). 1 day after transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... Shortly, hiPSC lines (C1, C2, C3) and the commercial human iPSC-line Chipsc4 (Takara, Sweden) were cultured and differentiated into cortical NSCs as described elsewhere (23) ...
-
bioRxiv - Cell Biology 2022Quote: Full length wild type human RORβ (NM_006914.3) was subcloned into the pLPCX retroviral vector (Clontech) using XhoI and NotI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2019Quote: PtK2 GFP-α-tubulin cells (stable line expressing human α-tubulin in pEGFP-C1; Takara Bio Inc. ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA encoding human full-length MuSK was cloned into pIRES2-EGFP plasmid vector (Clontech). AChR and MuSK vectors were kindly provided by Drs ...
-
bioRxiv - Molecular Biology 2022Quote: ... The bait stain was combined with a Mate & Plate™ Human Heart library (Takara Bio) for 24 hours after which cells were plated on selective synthetic defined (SD ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Aurora A and TPX2 were amplified from human testis cDNA (Marathon cDNA, Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... and SOX4 were amplified from a reverse transcript of Human Fetal Brain Total RNA (Takara) by high-fidelity PCR using Phusion DNA Polymerases (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Developmental Biology 2023Quote: ... The ORF of human KIF23 was cloned within pCAX vector using In-Fusion system (TaKaRa). The disease associated c.755T>A mutation was introduced to human KIF23 cDNA by the PCR-based mutagenesis as described (Xia et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... These plasmids were transformed into the yeast strain AH109 for testing protein-protein interaction using the Matchmaker Gold system (Takara Bio, Kusatsu, Japan). Yeast transformation and growth were performed as described in [Pecher et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of protein were incubated with TALON beads (Clontech) pre-equilibrated with purification buffer at RT for 1.5 h with overhead rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... the proteins were purified by TALON Metal Affinity Resin (Clontech) and filtered with Amicon Ultra 0.5ml (30K ...