Labshake search
Citations for Takara Bio :
51 - 100 of 736 citations for Recombinant Human CD3d Molecule Delta CD3 TCR Complex His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... His8-tagged soluble or insoluble CML recombinant proteins were purified at room temperature using Ni-NTA resin (His60, Takara Bio Inc.) using the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... His (Clontech), supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Cancer Biology 2019Quote: ... A full-length Myc tagged cDNA expressing human NEK9 (NM_001329237.1) was subcloned into the pVLX-Tight-Puro vector (Clontech). The RCC1 domain was deleted using the Quickchange® II XL Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Stratagene ...
-
bioRxiv - Immunology 2022Quote: ... TCR coding sequences were cloned into lentiviral backbones using InFusion HD (Takara), with oligonucleotides synthesized by IDT ...
-
bioRxiv - Immunology 2022Quote: ... The SMARTer Mouse TCR a/b Profiling Kit (Takara, Cat. No. 634403) was used to amplify both TCRα and TCRβ sequences ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630428, Clontech) or –Trp ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630419, Clontech) selective media +3 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (Clontech) with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-002 encodes a C-terminal FLAG-tagged version of human PKR hosted in the retroviral expression vector pLPCX (Clontech) and was generated by cloning a PCR product (PCRP ...
-
bioRxiv - Biochemistry 2023Quote: ... FL-human KANK1 (generous donation from the Bershadsky lab) cDNA was tagged in the C-terminal site with pmCherry (Clontech) by restriction digestion ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-His (Clontech 631212), anti-H3K36me2 (Upstate 07-369) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Molecular Biology 2020Quote: ... The complex was purified using TALON beads (Clontech) after nucleic acid precipitation using 0.05% of PolyEthylImine (PEI ...
-
bioRxiv - Immunology 2024Quote: ... genes encoding the variable regions of C7 and C74 heavy chains were cloned into a pMN vector with a human CH1 domain and a C-terminal His-tag using In-Fusion cloning system (Takara Bio #639649). The full light chains of C7 and C74 were cloned into the pMN vector without any purification tag using the same method ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Microbiology 2019Quote: ... containing 10% Tetracycline-free fetal bovine serum complex (Clontech) and 1% penicillin-streptomycin (100 U penicillin/mL ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant RNase inhibitor (Takara) and protease inhibitor cocktail (Sigma-Aldrich)) ...
-
bioRxiv - Systems Biology 2023Quote: ... Recombinant DNase I (TaKaRa) was used to digest DNAs ...
-
bioRxiv - Molecular Biology 2022Quote: The Delta PAS sfRps29 vector was generated by PCR using PrimeSTAR MAX Polymerase (Takara Bio) with primers containing the point mutation (forward ...
-
bioRxiv - Developmental Biology 2023Quote: ... HA hRB1 delta CDK was subcloned at BamHI restriction site on pIRES2-EGFP vector (Clontech). The Mcidas-GFP construct was a gift from S Taraviras ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA molecules were amplified using the Advantage 2 PCR kit (639206, Takara Bio) with initial denaturation at 95 °C for 1 min ...
-
bioRxiv - Bioengineering 2019Quote: ... SD-His or SD-Trp-Ura (Clontech). Mycoplasma pneumoniae strain M129 (ATCC 29342) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Immunology 2019Quote: ... 1.85U recombinant RNase Inhibitor (Takara), 1.85 μM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... The complex was then purified by binding on Talon resin (Clontech) and eluted in 150 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... EGFP tagged construct was generated in pEGFP-N1 (Clontech).
-
bioRxiv - Microbiology 2019Quote: ... and loaded on His 60 Ni resin (TAKARA) after equilibrating ...
-
bioRxiv - Microbiology 2022Quote: ... Western blots using Anti-His primary antibody (Clontech) (1:4000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2019Quote: ... Clarified lysates were incubated with HIS-60 (Takara) resin for 30-60 minutes ...
-
bioRxiv - Immunology 2021Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Biochemistry 2019Quote: ... and Recombinant RNAse i nhibitor (TaKaRa). cDNA was prepared from total RNAs using ReverTra Ace (TOYOBO) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Recombinant RNase Inhibitor (Takara, Japan) were added into the cell pellets ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant Ribonuclease Inhibitor (Takara), and 10 U/μL Enzscript Moloney-Murine Leukemia Virus Reverse Transcriptase (Enzymatics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Plant Biology 2020Quote: ... 3-μL aliquots of each dilution were used to inoculate SD/−Trp/−His/−Ade medium and SD/−Trp/−His medium with X-α-Gal (Clontech). The inoculated media were incubated for 4 days at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... sfGFP-tagged proteins were visualized with monoclonal anti-GFP (Takara). Anti-Sty1 polyclonal antibody (Jara et al ...