Labshake search
Citations for Takara Bio :
201 - 250 of 724 citations for Recombinant Human AK4 His & GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... HIS-Ub-conjugated proteins were purified by cobalt chromatography (TALON metal affinity resin, Clontech), as described in the manual ...
-
bioRxiv - Plant Biology 2021Quote: ... SD growth medium w/o Ade−His−Leu−Trp− (Himedia) and supplements media (Clontech) were used for the Y2H experiment.
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: ... and then grown on SD-Trp-Leu and SD-Trp-Leu-His plates (Clontech).
-
bioRxiv - Biochemistry 2023Quote: ... EPHA2- FN2 and antigen-A were purified using His 60 Ni Superflow resin (Takara), whilst antigen-B was purified with rProteinA Sepharose (GE Healthcare) ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a permanent C-terminal His-tag were purified using TALON (Clontech) resin followed by anion exchange using a Hitrap Q column (Cytiva) ...
-
bioRxiv - Molecular Biology 2020Quote: ... All CTD inserts were cloned into the BamHI and NotI sites of pQLink-GST using InFusion cloning (Addgene #138470-138472) (Clontech). pQLink-GST encodes an N-terminal GST tag followed by a TEV protease cleavage site.
-
bioRxiv - Biochemistry 2020Quote: Clarified lysates containing 6His-GST-AVI-PLpro or 6His-GST-AVI-PLpro E912R E948R M953E Y1013K (S1* mutant) were incubated with His60 Ni Superflow Resin (TaKaRa) for 1 hr at 4°C ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Cell Biology 2019Quote: GFP-tagged SAF-A alleles were cloned into the lentiviral expression vector pLVX-TetOne-puro (Takara) using In-Fusion cloning ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM DTT and 400 units/ml of Recombinant RNase Inhibitor (TaKaRa)) with cOmplete (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: The extracted RNA was treated with Recombinant DNase I (Takara Bio, Japan) to digest the remaining genomic DNA and was purified by phenol/chloroform/isoamyl alcohol (25:24:21 ...
-
bioRxiv - Microbiology 2020Quote: ... Purification tags were removed by treating recombinant proteins with HRV3C protease (TaKaRa) and cOmplete™ His-tag Purification Resin (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 mM dNTP and 2 U/mL of recombinant RNase inhibitor (Clontech) then spun down and frozen at −80°C ...
-
bioRxiv - Biochemistry 2019Quote: Recombinant DmNobo was expressed with the pCold-III plasmid vector (TaKaRa Bio) in Escherichia coli strain BL21(DE3 ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Physiology 2021Quote: ... supplemented with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A). Fresh dilution of 1 in 400,000 was prepared immediately before the first strand synthesis ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant plasmids were co-transformed into yeast Y2H Gold strain (Takara). The transformed yeast strains were grown on DDO (SD/-Leu/-Trp ...
-
bioRxiv - Immunology 2023Quote: The recombinant Lenti-X™ pLVX-IRES lentiviral vector expression system (TakaRa) was used to introduce Wuhan-Hu-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at-80°C ...
-
bioRxiv - Microbiology 2023Quote: ... Free DNA was removed via DNase treatment (Recombinant DNase I; Takara, Japan). Viral DNA was extracted using the DNeasy Blood & Tissue Kits (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... 0.1mM EDTA) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B). Nuclei were counted and kept on ice (or for longer storage at - 80°C) ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant CML13 and CML14 were purified via Ni-NTA His60 (Takara Biosciences.) and CaM7 using phenyl-sepharose (Sigma Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant cholix toxin was first purified on nickel metal affinity chromatography (Takara) and subsequent TEV protease-mediated 6His-MBP tag removal at 4°C/Over Night (ON) ...
-
bioRxiv - Cell Biology 2022Quote: ... was amplified by PCR and subcloned into pBacPAK-His3-GST construct (provided by Dr. Svend Kjaer, The Francis Crick Institute) via In-Fusion cloning method (Takara Bio). StrepII2x-ATG5 ...
-
bioRxiv - Biophysics 2019Quote: The resulting constructs were then transferred into pRSF-oRibo-Q1-oGST by using the GST-internal SwaI and post-H6 SpeI restriction sites and In-Fusion Cloning (Takara Bio). pRSF-oRibo-Q1-oGST was digested using SwaI and SpeI ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Molecular Biology 2020Quote: ... Both soluble and insoluble (cell pellet) fractions were purified via His-IDA nickel column (Clontech Laboratories ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the SMARTer Stranded Total RNA HI Mammalian kit (Takara 634873) with 0.5-1ug of RNA and samples were sequenced on the NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...
-
bioRxiv - Plant Biology 2023Quote: ... The yeast transformants were grown on nutrient-restricted (without Trp, Leu, His, Ade) mediums (Clontech) 3-5 days to assess interactions between various protein combinations.
-
bioRxiv - Biophysics 2023Quote: WT and R203M N175-245were purified using the TALON His-tag purification protocol (Clontech Laboratories). Cell pellets were lysed in high salt buffer (50 mM tris ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Tissues expressing mCherry-tagged Yellow protein (ymCherry) were stained with rabbit anti-dsRed (Clontech 632496, 1:1000) and rat anti-DN-Cadherin (DN-Ex #8 ...
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...
-
bioRxiv - Biophysics 2019Quote: ... The mEos3.2 tagged constructs used here are in Clontech N1 plasmid vector background (Clontech, Mountain View, CA).
-
bioRxiv - Cell Biology 2022Quote: ... the resulting Myc-tagged versions were then cloned into the BamHI site of pEGFP-N3 (Clontech Laboratories). Finally ...
-
bioRxiv - Microbiology 2020Quote: N-terminally Strep TagII tagged ZIKV Capsid was cloned to pLVX-TetOne-Puro Vector (Clontech, Cat: 631849) using BamHI & EcoRI cut sites ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by SDS–PAGE and immunoblotting with goat anti-GST (1:3000, Cytiva, 27-4577-01) and mouse anti-6xHis (1:3000, Takara Bio, 631212) antibodies ...
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant plasmids were transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763), and positive colonies were selected on LB plates containing spectinomycin (100ug/mL ...
-
bioRxiv - Microbiology 2022Quote: ... The thrombin-digested recombinant NA was incubated with TALON metal affinity resin (Takara) for 2 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and homogenization (NIM2 buffer supplemented with Recombinant RNase Inhibitor (0.4 U/μL, Takara), SUPERase in (0.2 U/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant plasmid was transformed into Stellar™ Competent Cells (Clontech, Catalog # 636763) according to the manufacturer’s protocol and positive colonies were selected on LB plates containing kanamycin (50 μg/mL).
-
bioRxiv - Pathology 2020Quote: ... followed by treatment with 10 U of recombinant DNase I (Cat.#2270A, TaKaRa) to remove residual DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...