Labshake search
Citations for Takara Bio :
251 - 300 of 1199 citations for Recombinant Human 5' Nucleotidase Ecto CD73 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: EGFP-tagged rat PKCδ cDNA were cloned into EcoRI and BamHI digested pRetroX-TetOne-Puro (#634307, Takara Bio) using In-Fusion cloning system (#639648 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP and mCherry tagged cDNA constructs were cloned into pBMN and modified pLXIN (Clontech, Mountain View, CA, USA) retroviral expression vectors(Peden et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... cloned into HA vector using HA tagged hNHE6.2-FL as template and using in-fusion snap method (Takara, In-Fusion® Snap Assembly Master Mix ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Microbiology 2020Quote: ... Purification of recombinant Ply was performed using Talon resin (#PT1320-1, Clontech Laboratories Inc.) affinity chromatography from freshly transformed BL21/DE3 E ...
-
bioRxiv - Biochemistry 2020Quote: Standard recombinant DNA techniques and In-Fusion® HD Cloning (Takara Bio USA, Inc.) were used for plasmids construction in this study and were verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant lentivirus titer was measured using Lenti-XTM GoStixTM Plus (ClonTech, catalog number: 631280). E0771 and RM-1 cells were transduced with lentiviral vectors carrying the luciferase expression cassette with TransDux MAXTM (System Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... These recombinant plasmids were transformed into Escherichia coli BL21 (Takara Bio Co Ltd, Japan) and the transformed cells were cultured at 37°C until the OD600 reached at 0.6–0.8 ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant AAV9 vectors were generated by co-transfection of AAVpro 293T cells (Takara Bio) with three plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... N-terminal Flag-tagged P38α containing 3C protease site was amplified by PCR using CloneAmp HiFi PCR Premix (Takara) and ligated in to pcDNA3 using the aforementioned restrictions sites ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of 6X-Histidine tagged cavin proteins was done using TALON metal affinity resin (ClonTech, Scientifix Cat No. 635503). Talon resin was thoroughly washed with 500GF buffer containing 5 mM imidazole to remove detergent and non-specifically bound proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Aer01 tagged with dTomato were labeled by incubating larvae in blocking solution containing Rabbit anti-dsRed (Takara Bio #6324960) at 1:500 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal loading of the GFP tagged E2F1 proteins was determined by the GFP antibody (Clontech, lot. 1404005; 1:2000) the secondary antibody anti-rabbit HRP (Na934v ...
-
bioRxiv - Plant Biology 2019Quote: Each purified protein preparation of His-PHOT1 N2 and N4 was incubated with TALON Magnetic Beads (TaKaRa) at 4°C for 30 min and further incubated at 4°C for 30 min with in vitro transcription and translation reactant containing RPT2 N ...
-
bioRxiv - Cell Biology 2022Quote: ... The library was generated by using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Clontech) with 1 μg RNA as input ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech) supplemented with 40mg/LX-α-gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Cell Biology 2020Quote: ... To detect the transgenic GFP-tagged Abl proteins we used anti-GFP (JL-8, 1:500 or 1:1000, Clontech). Anti-αTubulin (Sigma ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: The cDNAs for HA-tagged ELF3 were amplified from the KhES-1 cDNA library by PCR using PrimeSTAR GXL (Takara) and were subcloned into the pENTR/D entry vector (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: Doxycycline-inducible overexpression of HA-tagged proteins was achieved using the Lenti-X Tet-On 3G Inducible Expression System (Clontech) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: Expression plasmid for mouse FLAG tagged BAG3 (pFLAG-BAG3) was constructed by cloning partial mouse BAG3 cDNA containing the whole CDS into pEGFP-N1 (Clontech). Forward primer sequence used to clone BAG3 plasmid is 5′-AAAGGATCCAGCGCCGCCACCC-3′ and the reverse primer sequence is 5′-GACTCTAGATCACTAGGGAGCCACCAGGTTGC-3′ ...
-
bioRxiv - Cell Biology 2021Quote: The FKBP sequence was tagged to a 3xFLAG-LRRK2 vector using IN-FUSION HD cloning technology (Clontech, Takara, cat #638920). LYSO-LRRK2 was created by adding the N terminal domain of the LAMTOR1 sequence (aa 1-39 ...
-
bioRxiv - Cell Biology 2021Quote: The FKBP sequence was tagged to a 3xFLAG-LRRK2 vector using IN-FUSION HD cloning technology (Clontech, Takara, cat #638920). LYSO-LRRK2 was created by adding the N terminal domain of the LAMTOR1 sequence (aa 1-39 ...
-
bioRxiv - Cancer Biology 2019Quote: ... This plasmid was used as a template to generate GFP-tagged mutant versions Cdc42ep5GPS-AAA using In-Fusion cloning (Takara). To allow for lentiviral infection and stable expression ...
-
bioRxiv - Cell Biology 2021Quote: ... WT TARPs and ncAA-tagged TARPs were subcloned into a bidirectional doxycycline-inducible expression vector pTRE3G-BI (Takara Bio, #631332) using the restriction sites KpnI/XbaI ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Microbiology 2019Quote: ... TetON-IRE1-GFP MEFs were obtained by reconstituting Ire1-/- MEFs with GFP-tagged murine IRE1 under control of a ‘tight’ Tet-responsive element (Clontech) essentially as described (Bakunts et al ...
-
bioRxiv - Biochemistry 2019Quote: Hexa-histidine-tagged scaffolding protein (6 mg) was loaded on a 1 ml immobilized metal affinity chromatography column charged with cobalt (Clontech). Coat protein monomers (0.2 mg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-026 was generated by subcloning a DNA fragment encoding an N-terminus FLAG-tagged mouse eIF2α coding sequence flanked by BamHI and EcoRI sites into the BglII and EcoRI sites of pLPCX (Clontech) using standard molecular biology methods ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eukaryotic expression vectors encoding green fluorescent protein (GFP)-tagged proteins were generated by inserting PCR-amplified fragments into pd1-EGFP-N1 vector (6073-1, Clontech). Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single embryos were collected in 2 µl RNase free water with Recombinant RNase inhibitor (TAKARA) and ruptured with an RNase free needle ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant protein was purified using the His60 Ni gravity column purification kit (Takara Bio) according to the manual instruction ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant proteins of interest were bound to TALON metal affinity beads (Clontech, Mountain View, CA) and eluted with imidazole (gradient 10–200 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... with RNAse-free water with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A) and a fresh dilution of 1 in 300,000 was prepared before the first strand synthesis.
-
bioRxiv - Neuroscience 2022Quote: ... with RNAse-free water with 0.4 U/μL Recombinant RNase Inhibitor (Takara Clontech, Ref. 2313A) and a fresh dilution of 1 in 300,000 was prepared before the first strand synthesis.
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified from Escherichia coli BL21 (DE3) with TALON Metal Affinity Resin (Takara), Pierce Glutathione Agarose (Thermo scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... The recombinant construct was transformed into Escherichia coli StellarTM Competent Cells (dam–/dcm–) (Takara Bio) according to the supplier’s protocol (ClonTech ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA-sequencing libraries were made using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara). Libraries were sequenced at the Bauer Core Facility (Harvard University ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were prepared with the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara #634875). 75 bp single-end sequencing was performed using an Illumina NextSeq500 system at the CRI at UT Southwestern Sequencing Facility ...