Labshake search
Citations for Takara Bio :
301 - 350 of 682 citations for Recombinant E. coli MUG Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Recombinant AAV2 was packaged in HEK293T cells using pHelper and pRC2-mi342 plasmids (Takara, Catalog #632608). Three days after transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... under standard conditions with oligo(dT) or random hexamer primers and Recombinant RNase Inhibitor (RRI, TAKARA). Then the cDNA was subjected to quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Genomics 2023Quote: ... Recombinant AAV2 was packaged in HEK293T cells using pHelper and pRC2-mi342 plasmids (Takara, Catalog #632608). Three days after transfection ...
-
bioRxiv - Neuroscience 2023Quote: Each lysis plate well contained 4uL of lysis buffer (4U Recombinant RNase Inhibitor (Takara Bio 2313B), 0.05% Triton X-100 ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... coli cells and purified to near-homogeneity by metal-affinity chromatography using TALON resin (Takara Bio, USA). After purification ...
-
bioRxiv - Molecular Biology 2020Quote: Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each well of the 96-well plate contained 3µL lysis buffer (10U Recombinant RNase Inhibitor (Takara Bio), 0.2% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... RLK7ECD was fused with MIK2TK and inserted into the pUC19 vector using in-fusion recombinant enzymes (Clontech). After digestion with KpnI and SalI ...
-
bioRxiv - Microbiology 2021Quote: ... All expression vectors used the recombinant DNA techniques used the In-Fusion HD enzyme (Clontech, Felicia, CA). A series of deletion mutants of eqkeap1 (eqKeap1-ΔNTR ...
-
bioRxiv - Cancer Biology 2019Quote: Lysis plates were created by dispensing 0.4 µl lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% TritonTM X-100 (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcriptase-containing pseudoviral particles and recombinant reverse transcriptase standard of known concentrations (TAKARA, Cat. No. RR047A) were 10-timed diluted with nuclease-free water (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: The plasmid constructs used as repair template for recombinant virus generation were generated using InFusion cloning (TaKaRa). The sequence references below are based on the HSV-1 KOS genome accession number JQ673480 (Macdonald et al 2012) ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Evolutionary Biology 2020Quote: ... coli as a DNA template) with the Neo-selection gene by using In-Fusion HD Cloning kit (Takara), and integrated the resulting leuS-Neo DNA into genomes of the tavaborole-resistant cells by using the scarred method for insertion of a nonselectable DNA fragment recombineering protocol with Neo gene as a selectable marker49.
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized CHAF1A cDNA was first cloned into a pGEX-6P-1 vector via In Fusion (Takara) (Supplementary Table 3) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... fused with the SYFP2 coding region using recombinant PCR and cloned into pMSCV-Thy-IRES 1.1 vector (Clontech) using EcoRI/XhoI and ClaI restriction sites.
-
bioRxiv - Microbiology 2020Quote: ... for 15 min at 37°C in the presence of 80 U of recombinant RNase inhibitor (Takara Bio). Next ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant yeast strain was confirmed by PCR conducted with Matchmaker™ Insert Check PCR Mix (TAKARA, Japan). The full length of SlBES1.8 coding sequence was cloned into pGADT7 plasmid and subsequently transformed into the recombinant yeast strain ...
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Immunology 2020Quote: ... Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: Lysis plates were prepared by dispensing 0.4 µL lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Cells were lysed using Takara Bio Single Cell Lysis Buffer containing a recombinant RNase inhibitor (Takara Bio Inc.) then snap frozen ...
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Genomics 2021Quote: ... tissue or cells were placed in 2mL of EZ lysis buffer containing Recombinant RNase Inhibitor (Takara Bio 2313A), dounced 24 times with pestle A ...
-
bioRxiv - Genomics 2020Quote: Lysis plates were prepared by dispensing 0.3μL lysis buffer (4 U Recombinant RNase Inhibitor (RRI) (Takara Bio, 2313B), 0.12% Triton™ X-100 (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA was extracted using the hot phenol method and treated with recombinant DNase I (Takara, cat# 2270A) in the presence of RNasin Plus (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... for 15 min at 37°C in the presence of 80 U of recombinant RNase inhibitor (Takara Bio). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... by dispensing individual cells in 5 nL drops directly into 3 µL ice-cold single cell lysis buffer (scLB, 0.134% Triton X-100 [Sigma], 0.5 U/µL recombinant RNase inhibitor [Takara, 2313B] ...
-
bioRxiv - Immunology 2023Quote: ... 0.6% NP-40 and freshly added 1mM DTT) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B) and incubated for 5 minutes on ice ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were tagged with Gfp (enhanced green fluorescent protein; Clontech, Mountain View, CA, USA) at their N-terminus unless noted otherwise ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Microbiology 2019Quote: ... Each fragment was cloned into SmaI-digested temperature-sensitive vector pTH18ks1 (41) in Escherichia coli DH5α (Takara Bio Inc.).
-
bioRxiv - Bioengineering 2021Quote: ... coli BL21 (DE3) Gold cells harboring the corresponding expression plasmid and the TaKaRa chaperone-plasmid pTF16 (TAKARA BIO INC.) were used to inoculate 500 mL of autoinduction medium (464 mL LB medium ...
-
bioRxiv - Neuroscience 2022Quote: ... coli cells induced with 100 mM IPTG and purified from bacterial extracts using TALON beads (Takara Bio, Catalog # 635502) according to the vendor’s instructions.
-
bioRxiv - Genomics 2023Quote: ... The ligation reaction (1 µL) was transformed into 50 µL of Escherichia coli HST08 premium electro-cells (Takara, Japan) using a Gene Pulser Xcell (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli BL21 (DE3) containing a pGro7 plasmid for overexpression of the GroEL/ES chaperone system (Takara Bio, Shiga, Japan). ACP (acyl phosphatase ...
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...