Labshake search
Citations for Takara Bio :
1 - 50 of 314 citations for Recombinant Autographa Californica Multiple Nucleopolyhedrovirus Lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: A multiple-step overlap-extension PCR (Pyrobest Polymerase, Takara Bio) was used for site-directed mutagenesis and construction of chimeric protein constructs ...
-
bioRxiv - Cancer Biology 2021Quote: ... The multiple cloning site of a pIRES2-AcGFP1 plasmid vector (Takara Bio USA ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant proteins were extracted from this crude lysate by affinity purification with TALON Affinity Resin (Takara Bio USA, Mountain View, CA, USA), washed with a solution containing 50 mM sodium phosphate ...
-
bioRxiv - Cell Biology 2021Quote: For expression analysis human multiple tissue cDNA panel (MTC™ Clontech, 636742) and human normal brain tissue qPCR array (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant RNase inhibitor (Takara) and protease inhibitor cocktail (Sigma-Aldrich)) ...
-
bioRxiv - Systems Biology 2023Quote: ... Recombinant DNase I (TaKaRa) was used to digest DNAs ...
-
bioRxiv - Cancer Biology 2020Quote: ATCGAATCACCGGTCTAGGCGTAGTCGGGCACGT) and inserted it into the multiple cloning site of the pLVX-TetOne (ClonTech) plasmid by restriction enzyme digestion with EcoRI and AgeI ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified fragments were gel purified and used for In-Fusion Multiple Fragment Cloning (Clontech) according to manufacturer’s directions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Immunology 2019Quote: ... 1.85U recombinant RNase Inhibitor (Takara), 1.85 μM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Biochemistry 2019Quote: ... and Recombinant RNAse i nhibitor (TaKaRa). cDNA was prepared from total RNAs using ReverTra Ace (TOYOBO) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Recombinant RNase Inhibitor (Takara, Japan) were added into the cell pellets ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant Ribonuclease Inhibitor (Takara), and 10 U/μL Enzscript Moloney-Murine Leukemia Virus Reverse Transcriptase (Enzymatics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Microbiology 2021Quote: ... The multiple cloning site was expanded and the pyrithiamine resistance cassette was amplified from pPTR I (Takara) to include XhoI (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... 160 μl recombinant RNase inhibitor (Takara Clonetech), 1.6 ml of 10 mM dNTP (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... and treated with recombinant DNase I (Takara). The treated RNA was purified with an RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... 160 µL recombinant RNase inhibitor (Takara Clonetech), 1.6 mL of 10 mM dNTP (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1ul recombinant RNase inhibitor (Takara, 2313B) incubated on ice for 5min ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.2U/ml Recombinant ribonuclease inhibitor (Takara, #2313B). A second centrifugation (same conditions ...
-
bioRxiv - Immunology 2023Quote: ... and 5U of Recombinant RNAse inhibitors (Takara), and then were washed in 1x PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with recombinant DNase I (Takara). The treated RNA was subsequently purified using an RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.025 μL recombinant RNase inhibitor (Takara, 2313B), 0.04 μL reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.02 μL recombinant RNase inhibitor (Takara, 2313B) and 2.21 μL nuclease-free water per reaction (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 1.6 U Recombinant RNase Inhibitor (Takara, Japan), 0.5 μM random hexamer (IDT ...
-
bioRxiv - Genomics 2021Quote: Histone H4 was then cloned into the multiple cloning site of the pDendra2-C vector (Clontech catalog# 632546). The dCas9-3xGFP and C9-sgRNA plasmid for CRISPR imaging were a kind gift of Dr ...
-
bioRxiv - Molecular Biology 2021Quote: ... the gene encoding for eBFP1.2 was generated by multiple rounds of site-directed mutagenesis of pEGFP-C1 (Clontech). Next ...
-
bioRxiv - Genetics 2023Quote: ... the miR-34c locus was ligated into the multiple cloning site (MCS) of the pTetOne plasmid (Takara Bio).
-
bioRxiv - Plant Biology 2024Quote: Single or multiple DNA fragments were cloned into binary vector using In-Fusion HD Cloning Kit (Clontech, USA). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... scFv-mNeonGreen-GB1-NLS was assembled using In-Fusion® HD Cloning Plus multiple insert cloning (Takara Bio #638911) and integrated into the KpnI/SpeI sites of pCasper-attB-nos>tubulin3’UTR+1kb (containing the nos promoter in EcoRI to direct maternal expression and tubulin 3’UTR+1kb of downstream sequence in XbaI) ...
-
bioRxiv - Microbiology 2021Quote: For the generation of a tau-P301S expression plasmid the multiple cloning site (MCS) of the pLHCX vector (Clontech) was modified by inserting a synthetic MCS-sequence (ACCGGTCTCGAGGCGGCCGCGGCCAAAAAGGCCGGATCCGTTAACACCAAAAA ATGGCACGTGGCCGGCACGCGTGGGCCCGTCGAC ...
-
bioRxiv - Immunology 2021Quote: ... Cloning of HDR donor templates with over 2000 bp insert size was performed with multiple fragment In-Fusion cloning according to the manufacturer’s protocol (Clontech, Takara). In brief ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Plant Biology 2024Quote: Single or multiple DNA fragments were cloned into fungal transformation vector using In-Fusion HD Cloning Kit (Clontech, USA). Briefly ...
-
bioRxiv - Immunology 2019Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Genetics 2019Quote: ... 0.1μL Recombinant RNase-Inhibitor (40 U/μL, Clontech), and 2.8μL nuclease-free water ...
-
bioRxiv - Bioengineering 2021Quote: ... and Recombinant RNase Inhibitor were purchased from Takara Bio Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5 U/μl recombinant RNase inhibitor (Takara, 2313A) and 4 mg/ml biocytin and adjusted to pH 7.2 with KOH (290-300 mOsmol l-1) ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 ul recombinant RNase inhibitor (Takara, 2313B). Isolated nuclei were sorted on a MA900 Multi-Application Cell Sorter (Sony Biotechnology) ...
-
bioRxiv - Microbiology 2022Quote: ... 0.8 U/μl recombinant RNase inhibitor (Takara-Bio)] and incubated at room temperature for 10 min ...