Labshake search
Citations for Takara Bio :
351 - 400 of 5876 citations for Rat Oligodendrocyte transcription factor 1 OLIG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... a WST-1 cell proliferation assay kit (MK400, Takara Bio) was used according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The sequence of human histone H2A(K15C-129) was cloned into the pCold-Trigger factor (TF) vector (Takara Bio) with a SUMO coding sequence inserted to generate His6–TF–SUMO–H2A(K15C-129 ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2023Quote: candidate factors were prepared by subcloning the ORF template clones by PCR amplification with Prime STAR GXL DNA polymerase (Takara) and ligation by In-Fusion cloning enzyme (Clontech).
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was generated by oligo-dT primed reverse transcription with MMLV reverse transcriptase (SMARTScribe, Clontech) and a locked template-switching oligonucleotide (TSO) ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Reverse Transcription with SMART ® MMLV (Takara Bio USA, Mountain view, CA, USA). cDNA was synthesized using Oligo dT from 1 μg of total RNA ...
-
bioRxiv - Immunology 2022Quote: ... Reverse transcription to cDNA was performed with PrimeScrip RT Master Mix (RR036A, Takara Bio, Japan). The cDNA was used as a template for PCR amplification of the following gene coding sequences (primers shown in Supp ...
-
bioRxiv - Developmental Biology 2020Quote: ... Reverse transcription (RT) was performed using the PrimeScript RT master mix (cat. #RR036A, Takara, Japan). Real-time RT-PCR was performed in a StepOne plus system (ABI StepOne Plus ...
-
bioRxiv - Genomics 2020Quote: ... 3μl of reverse transcription (RT) mix was added (0.475μl SmartScribe [Takara], 0.125μl RNase inhibitor [Takara, cat no ...
-
bioRxiv - Microbiology 2021Quote: ... The in vitro transcription reaction was performed using T7 RNA polymerase (2540A; Takara Bio, Inc.) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The reverse transcription step was performed using Takara’s PrimeScriptTM RT Master Mix (RR036A; Takara, Japan). A brilliant SYBR green PCR master mix (4913914 ...
-
bioRxiv - Genomics 2022Quote: ... ten 50μL reverse transcription reactions were carried out using PrimeScript™ Reverse Transcriptase (Takara, #2680) and a gene specific primer (STARR_GSP ...
-
bioRxiv - Cell Biology 2023Quote: ... and reverse transcription was performed using RNA to cDNA EcoDry™ Premix (Clontech – Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2022Quote: Reverse transcription PCR (RT-PCR) was performed with 500 ng RNA per reaction by TaKaRa PrimeScriptTM RT Master Mix (Perfect Real Time ...
-
bioRxiv - Cell Biology 2023Quote: ... and reverse transcription was performed using RNA to cDNA EcoDry™ Premix (Clontech – Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription and first strand cDNA synthesis was performed using PrimeScript Reverse Transcriptase (Takara Bio Inc.). For gene expression analysis ...
-
bioRxiv - Systems Biology 2021Quote: ... 500 ng total RNA was used for reverse transcription with PrimeScript RT with gDNA eraser (Takara). For relative transcript quantification PowerUp SYBR Green (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was carried out using PrimeScript RT Master Mix (Takara Bio, Otsu, Japan. Ref: RR036A). Optical density analysis using a Nanodrop ND-1000 spectrophotometer (Labtech ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used for oligo(dT)18-primed cDNA synthesis according to the reverse transcription protocol (TaKaRa). The resulting cDNA was subjected to relative quantitative PCR using the SYBR Premix Ex Taq kit (TaKaRa ...
-
bioRxiv - Immunology 2023Quote: ... The viral copies were quantitated by reverse transcription quantitative PCR following the handbook (Takara, Cat.#RR086A). The copy numbers of reverse-transcripts from cell cultures and mice organ samples were normalized with the expression level housekeeping gene of beta-actin by using the 2(-Delta Delta C(T) ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription and quantitative real-time PCR were performed with PrimeScriptTM RT Master Mix (Takara, RR037A) and TB Green Premix Ex TaqTM II (Takara ...
-
bioRxiv - Neuroscience 2024Quote: ... which was conducted using oligo-dT-primed reverse transcription with SMARTScribe reverse transcriptase (Clontech, Cat#: 639538) and a locked nucleic acid containing template-switching oligonucleotide (TSO ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cDNA synthesis was followed by retrotranscribing reverse transcription with primer transcript II reverse transcriptase (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 400 ng of RNA was used for reverse transcription using PrimeScript RT Master Mix (Takara, USA). PCR reactions were performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Genomics 2019Quote: ... 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL; Clontech, 634936), 10-U/μL SMARTScribe™ Reverse Transcriptase (100 U/μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA samples were isolated from the rat liver using RNAiso Plus (D9109; TaKaRa, Dalian,China). RNA samples were converted to cDNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Ank only) rat Shank3 with a C-terminal mRFP-tag were generated in pmRFP-N3 (Clontech). A construct coding for N-terminally GFP-tagged full-length rat Shank3 in the pHAGE vector was obtained from Alex Shcheglovitov (Univ ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Txn1 cDNAs were amplified by PCR using LA-Taq polymerase (Takara Bio Inc, Shiga, Japan) with FW-primer ...
-
bioRxiv - Molecular Biology 2023Quote: We extracted total RNA from rat cells and tissues employing the TRIzol reagent (D9108A, TaKaRa Bio). The RNA was then reverse-transcribed into complementary DNA (cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... Virus production was quantified by determining the amount of the Gag p24 protein using an enzyme-linked immunosorbent (ELISA) assay (Innogenetics or TaKaRa). For production of HIV-1 Env-pseudotyped viruses in Jurkat cells ...
-
bioRxiv - Molecular Biology 2021Quote: Secretion in PIP in NHLFs treated with MRG-201 or MRG-229 was conducted by collecting the supernatant of treated cells and performing procollagen type I PIP ELISA (Takara).
-
bioRxiv - Evolutionary Biology 2021Quote: ... All RNA clones were prepared from the plasmids by in vitro transcription with T7 RNA polymerase (Takara) after digestion with Sma I (Takara) ...
-
bioRxiv - Immunology 2020Quote: ... at least 20 ng of input RNA was used for reverse transcription with SMARTscribe reverse transcriptase (Clontech). Whole transcriptome amplification (WTA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed by SYBR Green PCR Master Mix (Takara). The primer sequences for qRT-PCR were listed in Table S15.
-
Engineering of membrane complex sphingolipids improves osmotic tolerance of Saccharomyces cerevisiaebioRxiv - Bioengineering 2019Quote: Total RNA was extracted using MiniBEST universal RNA extraction kit and 1 μg was taken to synthesize cDNA using the PrimeScript II 1st-strand cDNA synthesis kit (TaKaRa, Japan). The cDNA mixture was diluted to about 100 ng/μl and used as the template for the gene expression level analysis by qRT-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... Pgcl2 and Pgcl3 cDNAs in male rat livers were amplified by PCR (PrimeSTAR DNA Polymerase Takara, Japan). The oligonucleotide primer sequences employed for this purpose are shown in Supplementary Table S1 ...
-
bioRxiv - Immunology 2021Quote: ... and quantitative reverse transcription-polymerase china reaction (RT-qPCR) was performed using SYBR Premix Ex Taq (TaKaRa, China). All procedures were performed following the manufacturer’s protocols.
-
bioRxiv - Plant Biology 2019Quote: ... 500 ng RNA was DNAse I-treated (ThermoFischer Scientific) and submitted to reverse transcription (Takara PrimeScript™ RT). Before qPCR ...
-
bioRxiv - Developmental Biology 2022Quote: ... and reverse transcription was performed to generate cDNA using the PrimeScript RT Master Mix (RR036; Takara, Kusatsu, Japan). The RNase-Free DNase Set (79254 ...
-
bioRxiv - Immunology 2020Quote: ... The reverse transcription of RNA into cDNA was performed using a Prime Script TM RT Master Mix (Takara). The following was the reaction system ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time reverse transcription-PCR was performed using a Thermal Cycler Dice real-time system MRQ (Takara Bio) with TB Green Premix Ex Taq II (Tli RNaseH Plus ...
-
bioRxiv - Physiology 2023Quote: ... Reverse transcription (RT)-PCR was performed using the Emerald Amp MAX PCR master mix (Takara Bio, Shiga, Japan). Quantitative RT-PCR was performed using THUNDERBIRD SYBR qPCR MIX (TOYOBO Life Science ...
-
bioRxiv - Developmental Biology 2022Quote: c-Kit-EGFP fusion protein: chicken c-Kit cDNA was inserted into multiple cloning site of pEGFP-N1 Vector (Clontech, #6085-1) including EGFP sequences using a primer set ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pHISi-1 vector was provided by the Matchmaker one-hybrid kit (Clontech, CA). The 40 bp promoter sequence was originally cloned from the maize C1 gene promoter (22) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 ug RNA was reverse transcribed using a PrimeScript RT-PCR kit (Takara Bio) by following the manufacturer’s instructions ...