Labshake search
Citations for Takara Bio :
101 - 150 of 5226 citations for Rat Nuclear Receptor Subfamily 4 Group A Member 2 NR4A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 infected patients were confirmed using a RT-qPCR kit (TaKaRa, Dalian, China) as recommended by the China CDC.
-
bioRxiv - Microbiology 2023Quote: ... 2×SYBR Green PCR Mastermix (RR820A) and reverse transcription kit (RR047A) were purchased from TAKARA company ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by 15 cycles of PCR using the Advantage 2 PCR Kit (Clontech) with template switching custom oligo (TableS6) ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Plant Biology 2021Quote: ... we used the nuclear system Y2H mating standard operating procedure method as described in the manufacturer’s instructions (Clontech Laboratories, Inc., USA) to screen the protein that interacts with TiAP1 and further verified the obtained interaction protein ...
-
bioRxiv - Immunology 2019Quote: ... using the manufacturers protocol and amplified using SMARTer Ultra Low Input RNA kit for sequencing (version 4, Clontech). Sequencing libraries were generated using TruSeq Nano DNA Sample Preparation kits (Illumina) ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 μg of total RNA was used for cDNA synthesis with PrimeScript 1st strand cDNA Synthesis Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... EGFP-positive cells from control and Yap1-5SA groups were directly collected into ice-cold lysis buffer (0.2 %Triton X-100, containing RNAse inhibitors, Clontech, cat# 635013) in 96-well plates (Eppendorf ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Microbiology 2023Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C with permanent mixing (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Neuroscience 2019Quote: Rat HRI was cloned into the Tet on-off system from Clontech (Tet-On® 3G Bidirectional Inducible Expression System with ZsGreen1 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-GFP (1:200;) and rabbit anti-dsRed (1:600; Clontech). The anti-GFP and anti-dsRed antibodies were used to amplify the intrinsic fluorescent signals in the Ccr2RFP/+fmsEGFP/+ mice ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-seq library was generated using the SMART-seq v.4 Ultra Low Input RNA Kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Full length cDNA were generated from 4 ng of total RNA using Clontech SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Takara Bio Europe ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA libraries for used for sequencing of 4 total RNA samples were synthesized using a SMART-Seq Ultra Low Input RNA kit (Takara) in the OHSU Massively Parallel Sequencing Shared Resource Core Facility ...
-
bioRxiv - Developmental Biology 2021Quote: The reverse-stranded total RNA-seq libraries (Fig. 4 and Fig. S2A) were prepared using the SMARTer-Seq Stranded kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 × 106 HEK293T cells were transfected with 4 μg donor and 2.5 μg pX330 Cas9 plasmid (CalPhos™ Mammalian Transfection kit, Clontech). After 72 h ...
-
bioRxiv - Microbiology 2021Quote: ... were added to the lysates of single parasites and libraries were prepared using SMART-Seq v.4 Ultra Low Input RNA Kit (Takara) using a quarter of the reagent volumes recommended by the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... Libraries from 4-cell embryos were also prepared using 18-30 nt gel purified RNA using the SMARTer smRNA-Seq Kit (Clontech) and NEXTflex-Small-RNA-Seq (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Immunology 2021Quote: ... First strand cDNA synthesis was performed with 4 μg of total RNA per reaction using PrimeScript™ II 1st Strand cDNA Synthesis Kit and oligo-dT primer (TAKARA) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA libraries were synthesized with 4 ng of total RNA input to the Clontech SMARTer smRNA-seq kit (Takara Bio 635034) using the manufacturer’s suggested protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Complementary DNA (cDNA) synthesis was carried out with 1 μg of RNA using the PrimeScript RT reagent kit (Takara-#RR037A-4). The cDNA was diluted and semiquantitative and Real-time PCR techniques were performed ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...