Labshake search
Citations for Takara Bio :
401 - 450 of 5354 citations for Rat Insulin Like Growth Factor Binding Protein 5 IGFBP5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following antibodies were used: rabbit or rat anti-dsRed (1:200, Clontech 632496 or 5F8 1:400, Chromotek 5f8-100); chicken anti-GFP (1:800 ...
-
bioRxiv - Cell Biology 2024Quote: ... rat cerebral cortexes or fly brains using TRIzol and the reverse transcription was performed with PrimeScript™ RT Master Mix (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Microbiology 2022Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat# 635683) column was equilibrated with ten column volumes of Equilibration Buffer (HisTALON Buffer Set ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 5 μL of Premix Ex Taq (Takara, Dalian, China), and 1.5 μL of a mixture of probe (5’-TGCAC GTTGT GACAG TCGT-3’ ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 2.5 mM dNTPs (Takara Bio Inc.), 1 μL of 20 μM TruSeqUniv (Supplementary Table S7) ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 10× ExTaq buffer (Takara Bio Inc.), 5 μL of 2.5 mM dNTPs (Takara Bio Inc.) ...
-
bioRxiv - Genetics 2020Quote: ... 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa, Shiga, Japan), self-ligated by T4 ligase (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: ... The 5 mL HisTALON cartridge (Clontech Laboratories, Cat # 635683) column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 units of recombinant DNase I (TaKaRa, Kyoto, Japan), 200 units of RevertAid™ reverse transcriptase (Thermo Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 U of Taq DNA polymerase (TaKaRa Bio) was subjected to PCR using a thermal cycler (Applied Biosystems 7300 real-time PCR system ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 5 µL of 2.5 mM dNTPs (Takara #4025), with the following thermal cycle condition ...
-
bioRxiv - Genetics 2023Quote: ... mixed with 5 mL Lenti-X Concentrator (Takara, 631232) and rocked at 4 °C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... a plasmid expressing enhanced green fluorescent protein (EGFP) (Clontech), or in another series of experiments with pVSV-G ...
-
bioRxiv - Biophysics 2020Quote: ... The protein was initially purified using Talon resin (Clontech) with a linear gradient of 50 to 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using TALON Metal Affinity Resin (Clontech) and dialyzed overnight against PBS buffer ...
-
bioRxiv - Immunology 2020Quote: ... The protein concentration was determined by Bradford assay (Takara), and the cell lysate was mixed with 4x Laemmli loading buffer containing β mercapto-ethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... Bound proteins were detected using Hyper HRP Substrate (Takara). PtIns(3,5)P2 Grip protein (P-3516-3-EC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Proteins were bound to TALON SuperFlow IMAC resin (Takara) overnight ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Plant Biology 2023Quote: ... These plasmids were transformed into the yeast strain AH109 for testing protein-protein interaction using the Matchmaker Gold system (Takara Bio, Kusatsu, Japan). Yeast transformation and growth were performed as described in [Pecher et al. ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Immunology 2020Quote: ... and mCherry was amplified from pTRE-Dual2 (Clontech # PT5038-5). pAF137 was constructed by amplifying the devil 41BB extracellular domain with primers pAF137-1.FOR and pAF137-1.REV and amplifying mCherry with pAF137-2a.FOR and pAF137-2.REV (Table S3-4) ...
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Physiology 2022Quote: ... The rat IGF1 coding sequence was then inserted into the linearized scAAV-CMV plasmid using In-Fusion cloning (Takara Bio; Cat. No. 639650). The resulting plasmids for scAAV-CMV-GFP and scAAV-CMV-IGF1 were packaged using AAV2/9 serotype by Vector Biolabs (Malvern ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of protein were incubated with TALON beads (Clontech) pre-equilibrated with purification buffer at RT for 1.5 h with overhead rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... the proteins were purified by TALON Metal Affinity Resin (Clontech) and filtered with Amicon Ultra 0.5ml (30K ...
-
bioRxiv - Synthetic Biology 2021Quote: ... concentrated proteins were determined those concentrations with Bradford (Takara Bio) or BCA (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
bioRxiv - Cell Biology 2020Quote: ... The solubilized protein was purified by Talon-resin (Clontech/Takara) using the hexa-histidine-tag fused at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2020Quote: ... The solubilized protein was purified by Talon-resin (Clontech/Takara) using the hexa-histidine-tag fused at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein was purified on a His60 Ni Superflow column (Clontech) according to the manufacturer’s instructions ...