Labshake search
Citations for Takara Bio :
201 - 250 of 5194 citations for Rat Hepatitis A virus cellular receptor 2 homolog HAVCR2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl purified cDNA was amplified with an Advantage HF 2 PCR kit (Takara) in a 25 µl reaction containing 0.5 µl forward primer (10 µM ...
-
bioRxiv - Microbiology 2023Quote: ... followed by RT-PCR using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa) with primers no ...
-
bioRxiv - Neuroscience 2022Quote: ... The titer of AAVs was measured by using AAVproR titration kit ver.2 (Takara).
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies used were: rat monoclonal mCherry (1:2000, Clontech); mouse monoclonal tyrosine hydroxylase (TH ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-E-cadherin rat monoclonal antibody (Takara, M108, 1:500), anti-GFRα1 goat polyclonal antibody (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... and rat anti-E-cadherin (1:200, Takara Bio, M108). Next ...
-
bioRxiv - Immunology 2020Quote: ... The entirety of each of the annotated intracellular domains was ordered as a separate gene fragment (Integrated DNA Technologies) and each complete receptor was cloned into pHR lentiviral expression vector (Clontech). Each region of the protein was amplified using PCR and fragments were combined using Gibson assembly.
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Genomics 2023Quote: ... A total of 3.5 μl ribo-depleted material was used for SMARTer (SMARTer PCR cDNA Synthesis Kit, catalog num. 634926 and Advantage 2 PCR kit, catalog num. 639207, Clontech-Takara) protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... The collected media containing virus was filtered through 0.45μm pore filter and mixed with Lenti-X concentrator (Clontech) as indicated by manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... The vaccinia virus DNA polymerase was used to clone the protospacers into a lentiviral construct (In-fusion, Takara). The lentiviral construct was linearized by Bfua1 digestion (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells expressing lentiviral vectors were created by following the manufacturer’s instructions for virus preparation and cell infection (Clontech). Cells were selected for expression by treatment with puromycin ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells expressing lentiviral vectors were created by following the manufacturer’s instructions for virus preparation and cell infection (Clontech). Cells were selected for expression by treatment with puromycin ...
-
bioRxiv - Cell Biology 2023Quote: ... The viral supernatants were collected 72 hr after transfection followed by virus concentration using Lenti-X concentrator (TaKaRa). Virus containing media was added to ATG3 KO HeLa cells with 8 μg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... Three volumes of concentrated virus medium were subsequently mixed with one volume of Lenti-X concentrator (Takara Bio) and rotated at 4°C overnight before centrifugation (1500 g for 45 min at 4°C) ...
-
bioRxiv - Biophysics 2023Quote: ... The virus of each construct was produced in Lenti-X™ 293 T Cell Line (Takara, Cat. #632180) and previously described74 ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus containing media was collected from the LentiX-293T cells and concentrated using Lenti-X Concentrator (Takara Bio). pLVX-Tet3G virus and polybrene was added to L6-myoblast cells and cells were positively selected using neomycin to create Tet3G expressing cells ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Immunology 2023Quote: T cell receptors were generated by custom synthesis (Twist Bioscience) in a 3rd generation pLVX-EF1α-IRES-Puro lentiviral vector (Takara/Clontech). Following the TransIT-Virusgen Transfection (Mirus ...
-
bioRxiv - Evolutionary Biology 2020Quote: PCR amplification was carried out using the Advantage GC 2 PCR Kit (Clontech Catalog #639119), and cloning was carried out using standard procedures (primer sequences are listed below).
-
bioRxiv - Genomics 2021Quote: ... and 2) the reduction of the amount of PrimeStar GXL DNA Polymerase kit (Takara, Japan) from 2 ul to 1 ul per reaction.
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 infected patients were confirmed using a RT-qPCR kit (TaKaRa, Dalian, China) as recommended by the China CDC.
-
bioRxiv - Microbiology 2023Quote: ... 2×SYBR Green PCR Mastermix (RR820A) and reverse transcription kit (RR047A) were purchased from TAKARA company ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by 15 cycles of PCR using the Advantage 2 PCR Kit (Clontech) with template switching custom oligo (TableS6) ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Cell Biology 2019Quote: ... Virus was produced by transfection of 293FT cells with pBABE- vimentin and pCL-Eco using Xfect transfection reagent (Clontech) and collection of supernatants 48 and 72hrs post transfection ...
-
bioRxiv - Immunology 2021Quote: ... 48hrs later the virus-containing supernatant from HEK-293T cells was concentrated 100-fold using Lenti-X concentrator (Takara). Titration was performed on HEK293T cells (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... Virus is produced by transfection of 293FT cells with pBABE-vimentin and pCL-Eco using Xfect transfection reagent (Clontech) and collection of supernatants 48 and 72 hours post transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... after which virus-containing supernatants were harvested and concentrated approximately 40-fold using Lenti-X Concentrator (Takara Bio, 631232) per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... bone marrow was harvested and transduced with SINV virus on plates coated with 10 μg/cm2 Retronectin (T100, Takara) for 1.5-2 hrs at 650×g and 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Supernatant containing virus was collected 48 h later and 10-X concentrated using Lenti-X Concentrator (Takara Bio, Germany). AML-12 wild-type cells were transduced using concentrated virus and selected using 3 μg/mL of puromycin ...
-
bioRxiv - Cell Biology 2023Quote: ... Retroviruses with the vesicular stomatitis virus–G (VSV-G) envelope were produced by transfection of GP2-293 cells (Clontech) with the pRetroX construct and pVSV-G (Clontech ...
-
bioRxiv - Cell Biology 2023Quote: ... after which virus-containing supernatants were harvested and concentrated 20-fold using a Lenti-X Concentrator (Takara Bio Inc.) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 13.32 (WT female) and 13.33 (WT male) were transduced with virus bearing either the empty pLVX-EF1a-IRES-ZsGreen1 vector (Takara), or the same plasmid expressing the coding sequence of C181 as described in lentivirus transduction ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Supernatant was collected at 48- and 72-hours post transfection and virus was concentrated using Lenti-X™ concentrator (Takara) and resuspended in appropriate volumes of MEM ...
-
bioRxiv - Neuroscience 2021Quote: ... Virus was then concentrated from the media 1:10 in PBS using Lenti-X concentrator (Takara Bio, Cat. No. 631231), aliquoted and stored at −80°C for future use.
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... ORFV120 and ORFV113 coding sequences were PCR-amplified from orf virus strain OV-IA82 genome and cloned into p3xFlag-CMV-10 vector (pFlag) (Clontech).
-
bioRxiv - Neuroscience 2023Quote: ... and AAV1-syn-F14F15S-sTpEptTA_v2 were made by transfecting 8×15c plates (per virus) of HEK 293T cells using Xfect transfection reagent (Takara 631318). Briefly ...
-
bioRxiv - Systems Biology 2023Quote: ... were delivered by spinfection into 100k cells using 1 mL of unconcentrated lentivirus or virus that was concentrated 5x with LentiX Concentrator (Takara). Blasticidin was added at day 3 or 5 to select for dCas9 delivery ...
-
bioRxiv - Neuroscience 2024Quote: Media was collected 48 h after transfection and clarified by syringe filtration through a 0.45 µm polyvinylidene difluoride membrane (Millex-HV) before concentrating the virus with a Lenti-X concentrator (Clontech 631231). The concentrated virus was resuspended in PBS and aliquoted into single-use tubes stored at −80 °C ...
-
bioRxiv - Neuroscience 2019Quote: Rat HRI was cloned into the Tet on-off system from Clontech (Tet-On® 3G Bidirectional Inducible Expression System with ZsGreen1 ...