Labshake search
Citations for Takara Bio :
51 - 100 of 945 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... plasmid or the enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1, Clontech/Takara Bio Europe). Transfections were achieved using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmid or the enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1, Clontech/Takara Bio Europe). Transfections were achieved using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... transfections also contained 0.2 μg of the pEGFP plasmid (Enhanced Green Fluorescent Protein plasmid, Clontech), and EGFP expression served as a marker of transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... plasmids were rescued from yeast using the Easy Yeast Plasmid Isolation Kit (Clontech Takara Bio). Protein interactions were confirmed by co-transformation of the Nwd1 bait with each candidate prey plasmid into Y2H Gold yeast host cells ...
-
bioRxiv - Neuroscience 2020Quote: ... plasmids were rescued from yeast using the Easy Yeast Plasmid Isolation Kit (Clontech Takara Bio). Protein interactions were confirmed by co-transformation of the Nwd1 bait with each candidate prey plasmid into Y2H Gold yeast host cells ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviral plasmids were packaged into pseudoparticles via triple-plasmid co-transfection into HEK293T cells (TaKaRa). pTsin or pWPI plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Biochemistry 2022Quote: ... Both pFCDUET-YopH phosphatase and pGKJE8-GroEl/GroEs chaperones plasmids (Takara chaperone plasmid set cat. # 3340) were used for co-expression experiments ...
-
bioRxiv - Plant Biology 2022Quote: ... prey plasmids from library were rescued from yeast clones with “Easy Yeast Plasmid Isolation Kit” (Clontech) and sequenced ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting plasmids were used to generate the R mutant plasmid using the TaKaRaMutanBEST Kit (Takara). All strains were validated using the methods described earlier.
-
bioRxiv - Molecular Biology 2024Quote: ... and plasmid DNA was isolated using NucleoSpin® Plasmid (NoLid) kit for miniprep (740499.250; Takara Bio) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were constructed by PCR amplification of the whole plasmids with the CloneAmp Hifi polymerase (Takara) and assembly of the insert part with the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Neuroscience 2019Quote: Rat HRI was cloned into the Tet on-off system from Clontech (Tet-On® 3G Bidirectional Inducible Expression System with ZsGreen1 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-GFP (1:200;) and rabbit anti-dsRed (1:600; Clontech). The anti-GFP and anti-dsRed antibodies were used to amplify the intrinsic fluorescent signals in the Ccr2RFP/+fmsEGFP/+ mice ...
-
bioRxiv - Bioengineering 2020Quote: ... Original pAUR101 plasmid purchased from Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... and the plasmid encoding DsRed2 (Clontech), cloned into a pCAX vector ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid pEGFPN1 was obtained from Clontech. TMPRSS2-FL cDNA (pcDNA3.1-SARS-2-S-C9 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid pRetroX-Tight-Pur (Clontech) and the PCR products have been digested with BamHI and EcoRI ...
-
bioRxiv - Microbiology 2021Quote: The plasmid pPTR I (Takara Bio), which carries the ptrA gene ...
-
bioRxiv - Microbiology 2021Quote: The plasmid pPTR I (Takara Bio) was used to construct the overexpression vector for the A ...
-
bioRxiv - Microbiology 2021Quote: ... or plasmid pPTR I (Takara Bio) were used as template DNA ...
-
bioRxiv - Microbiology 2021Quote: ... and plasmid pPTR I (Takara Bio) were used as template DNA ...
-
bioRxiv - Neuroscience 2022Quote: ... pRC2-mi342 and pHelper plasmids (TAKARA). Seventy-two hours after transfection using Polyethylenimine HCl Max ...
-
bioRxiv - Neuroscience 2019Quote: ... A pmCherry-N1 plasmid (ClonTech, 632523) was utilised as a morphological marker in HEK293 immunocytochemistry experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... A peGFP-N2 plasmid (ClonTech, 632483) was utilised as a morphological marker in subsequent proliferating CTX0E16 experiments due to red fluorescent protein aggregation in CTX0E16 hNPCs.
-
bioRxiv - Neuroscience 2022Quote: ... mCherry of pmCherry-C1 plasmid (Clontech) was subcloned into pAAV-hSyn-EGFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pmCherry-C1 from Clontech modified to add a myristoylation and palmytoylation sequence plus a linker (ATGGGCTGCATCAAGAGCAAGCGCAAGGACAACCTGAACGACGA CGGCGTGGACgaaccggtcgccacc ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pEGFP-C1 plasmid (Clontech V012024) was used as the control ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmids were midi-prepped (Takara Bio), and BestGene ...
-
bioRxiv - Neuroscience 2023Quote: ... the eYFP encoding cDNA plasmid (Clontech) was precipitated onto colloidal Au particles (1.6µm ...
-
bioRxiv - Microbiology 2023Quote: ... and isolated by NucleoSpin Plasmid (TaKaRa). The introduced mutation was verified by Sanger sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... into ECFP-C1 expression plasmid (Clontech).
-
bioRxiv - Microbiology 2023Quote: ... pGP packaging plasmid (TaKaRa, Cat# 6160), and pMD2.G plasmid with TransIT-293 Transfection Reagent (TaKaRa ...
-
bioRxiv - Bioengineering 2019Quote: Plasmid pRM01 was made by sequential addition of two DHFR homology regions to plasmid pEGFP-C1 (Clontech). First ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... and used for plasmid DNA preps using the Endotoxin-Free Nucleobond Plasmid Midiprep kit (Takara Bio; 740422.10). The HuEpi library was sequenced and contains all 5,309 sgRNAs included in the synthesis (GSE215430).
-
bioRxiv - Microbiology 2022Quote: ... and used for plasmid DNA preps using the Endotoxin-Free Nucleobond Plasmid Midiprep kit (Takara Bio; 740422.10). The HIVDEP library was sequenced and contains all 4,191 sgRNAs included in the synthesis (GEO Dataset ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids coding EGFP-mutants were generated from EGFP-IRES-mCherry plasmid using TaKaRa MutanBEST Kit (TaKaRa, Kusatsu, Japan). pG5egfp reporter vector was modified from the pG5luc vector (GeneBank Accession Number AF264724 ...
-
bioRxiv - Bioengineering 2023Quote: The helper plasmid and the AAV-ITR plasmid with a reporter gene (pAAV-ZsGreen1) were acquired from Takara Bio ...
-
bioRxiv - Neuroscience 2019Quote: PLVX-cherry-C1 plasmid was from Clontech and Mtss1L coding region was cloned into the C-terminus of mCherry between BsrG1 and SmaI sites to generate fusion construct of PLVX-cherryC1-Mtss1L (Mtss1L coding region sequence Accession number B) ...
-
bioRxiv - Biochemistry 2020Quote: ... A parent pLVX-TetOne plasmid (Takara Bio) was modified by 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmid pTet-tTs was from Clontech (#631011). A plasmid consisting of human lamin A cloned into pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were transformed in Stellar cells (Takara) and prepped for sanger sequencing and lentivirus production ...
-
bioRxiv - Cell Biology 2019Quote: The pMito-DsRed2 plasmid was from Clontech. Addgene provided pcDNA3-mRuby2 (#40260) ...
-
bioRxiv - Cell Biology 2019Quote: pLVX Ires-Neo lentiviral plasmid from Clontech was cut with EcoRI/MluI to remove the IRES-neo cassette ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The Guide-it plasmid vector (Takara Bio) was used to construct CRBN-KO cells ...
-
bioRxiv - Cell Biology 2021Quote: ... a NucleoSnap Plasmid Midi kit (Takara Bio) was used ...
-
bioRxiv - Immunology 2020Quote: ... plasmids were transformed into Stellar Cells (Takara) and grown overnight in 2XYT/carbenicillin cultures ...
-
bioRxiv - Microbiology 2022Quote: ... pGFP-N1 plasmid (Clontech, GenBank accession # U55762) was used for GFP expression ...
-
bioRxiv - Neuroscience 2022Quote: ... The pEGFP-C1 plasmid is from Clontech (Addgene plasmid # 13031 ...
-
Reduction of Spermine Synthase Suppresses Tau Accumulation Through Autophagy Modulation in TauopathybioRxiv - Neuroscience 2023Quote: ... and plasmids expressing EGFP (pEGFP-C1, Clontech) or Tau into SH-SY5Y cells (CRL-2266 ...