Labshake search
Citations for Takara Bio :
201 - 250 of 5663 citations for Rat Anti Muellerian hormone type 2 receptor AMHR2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline (Takara) was added on day 0 to induce TetO gene expression ...
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.
-
bioRxiv - Neuroscience 2021Quote: ChIP-seq libraries were generated from ChIP-DNA using a custom Illumina library type on an automated system (Apollo 342, Wafergen Biosystems/Takara). ChIP-seq libraries were sequenced on Illumina NextSeq 500 as single-end 75bp reads (Active Motif).
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... a DNA fragment of the TkR86C coding region was amplified from cDNA from the Canton-S wild type strain by PCR (PrimeSTAR GXL, TaKaRa Clontech) with primers that had NotI and XbaI sites at 5’ and 3’ ends ...
-
bioRxiv - Cancer Biology 2021Quote: ... The wild-type BTK construct was cloned in the base vector (Lenti-X Expression System Version EF1-a; Takara Bio). STable over-expression of BTK in ibrutinib-resistant DLBCL cells was performed by using lentiviruses expressing human wild-type BTK as described previously.[15]
-
bioRxiv - Biochemistry 2022Quote: ... wild type and mutant constructs of full-length PKD1 were cloned into the EGFP-C1 and mCherry-C1 vectors (Clontech), resulting in N-terminally labelled fusion proteins ...
-
bioRxiv - Genetics 2021Quote: ... full-length cDNA encoding MELK was inserted between BamHI and NotI sites of three types of retroviral plasmids including the pRetroX-Tight-puro (Clontech), pRetroX-Tight-GFP-puro (containing N-terminal GFP ...
-
bioRxiv - Immunology 2021Quote: To construct NPM1 lentivector the mutant NPM1 cDNA (mutation type A, TCTG duplication) was cloned into the pLVX-EF1α-IRES-ZsGreen vector (Clontech) using EcoRI and BamHI restriction sites.
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from 14-day-old thalli of the wild type and Mpacl5 mutants grown on the half-strength B5 agar medium using NucleoSpin RNA Plant (Takara). The sequence libraries were generated by TruSeq RNA Sample Prep Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Neuroscience 2020Quote: The screen of a rat brain cDNA library was carried out with the GAL4-based MATCHMAKER system (Clontech) and all procedures followed the system protocols ...
-
bioRxiv - Neuroscience 2023Quote: EGFP-tagged rat PKCδ cDNA were cloned into EcoRI and BamHI digested pRetroX-TetOne-Puro (#634307, Takara Bio) using In-Fusion cloning system (#639648 ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The BLRP-tagged wild-type and pBox mutant ERα cDNAs were cloned into a retrovirus-based Tet-On expression vector pRetroX-Tight-Pur (Clontech #632104) 19 ...
-
bioRxiv - Neuroscience 2021Quote: ... a DNA fragment of the TkR86C coding region was amplified from cDNA from the Canton-S wild type strain by PCR (PrimeSTAR GXL, TaKaRa Clontech) with primers that had NotI and XbaI sites at 5’ and 3’ ends ...
-
bioRxiv - Genetics 2022Quote: ... the ptetO7-ALA1 strain was transformed with a vector (pAG425) to express wild-type or mutant AARS1 and grown on media lacking leucine (DO Supplement -Leu, Takara Bio). One colony was picked ...
-
bioRxiv - Neuroscience 2022Quote: ... The full-length wild-type TRPV4 was subcloned into the PLVX-IRES-mCherry vector to generate TRPV4WT (Clontech, Catalog No. 631237). To generate the TRPV4FeRIC construct ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from 8-week-old wild-type or Inka2-/- mice forebrains using the RNAiso Plus reagents (Takara Bio). PolyA+ mRNA was extracted from total RNA using Oligotex TM-dT30 mRNA Purification Kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T expressing either iRhom2-1-374 or wild-type iRhom2 under TET-inducible cells were generated by lentiviral infection using gene cloned into pLVX-TetOne vector (Clontech, #631849). Methodology is similar to retroviral transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Gαi2 and Trpc2 cDNAs were amplified by PCR from female rat VNOs (PrimeSTAR® GXL DNA Polymerase Takara, Japan). Vom1r68 was synthesized by BGI (China) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Neuroscience 2021Quote: ChIP-seq libraries were generated from ChIP-DNA using a custom Illumina library type on an automated system (Apollo 342, Wafergen Biosystems/Takara, Active Motif). ChIP-seq libraries were sequenced on Illumina NextSeq 500 as single-end 75bp reads (Active Motif).
-
bioRxiv - Microbiology 2023Quote: The whole Gag sequence was amplified from wild-type Gag plasmid by PCR and cloned into pGEX6P1 and pmCherry-C1 (Takara Bio Inc.). Fragments of MAp17 (a.a ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Genetics 2019Quote: ... liver and kidney), mouse tissues (brain, liver, heart, testis and kidney) and rat tissues (brain, liver and kidney) were purchased from Takara Bio Inc.
-
bioRxiv - Neuroscience 2023Quote: ... Full-length and truncated Cntn1 was PCR amplified from rat contactin-myc 34 and ligated together using an In-Fusion Snap Assembly Master Mix (Takara). All DNA constructs were verified by sequencing (Genewiz and plasmidsaurus).
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg cDNA (Takara, Clonetech, USA) was prepared as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 × 106 Lenti-X 293T cells (Clontech) were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Microbiology 2020Quote: ... or Advantage 2 Polymerase mix (Takara Bio) for amplification of UTRs and Pfmyob ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...