Labshake search
Citations for Takara Bio :
1 - 50 of 3028 citations for RNA Binding Motif Protein 45 RBM45 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA-binding protein expressing vector was based on the shuttle vector pGADT7 (Clontech, USA) and constructed as described previously [25] ...
-
bioRxiv - Plant Biology 2023Quote: ... and a rabbit LexA binding domain antibody (Clontech), respectively.
-
bioRxiv - Immunology 2021Quote: ... Additional to the NF-κB binding motifs NF-κB response element and a TATA-like sequence from pNFκB-Luc vector (Clontech Cat. No. 631904) were added to the Firefly luciferase gene and introduced into pCDH-CMV-EF1-Puro.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP.
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Plant Biology 2019Quote: ... western blot and immuno-detection using monoclonal antibodies raised in mouse against the GAL4 activation or binding domain (1:10000 dilution, Clontech, www.clontech.com) following the Matchmaker Monoclonal Antibodies User Manuel from Clontech ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA-protein mix was catalyzed by proteinase K (Takara, 9034) at 55 °C for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... the YFP protein was detected using the GFP antibody (Clontech) at 1/5,000th and the UGPase antibody (Agrisera ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 °C for 45 min and the supernatants incubated with TALON beads (Clontech) pre-equlibrated with purification buffer at RT over night with overhead rotation followed by washing with wash buffer (8M urea ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... and 45 μL Trans IT-293 Transfection Reagent (Takara Bio Inc., Otsu, Japan). After 15 min ...
-
bioRxiv - Plant Biology 2020Quote: ... YFP-CESA6 protein was detected using anti-GFP antibody (Takara, catalog # 632381) and SEC12 was detected using anti-SEC12 antibody (Bar-Peled and Raikhel ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech ...
-
bioRxiv - Biophysics 2020Quote: ... The complex was then purified by binding on Talon resin (Clontech) and eluted in 150 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: ... Mutants (N127143Q and motif substitutions) were obtained by mutagenesis PCR using CloneAmp HiFi PCR Premix (TakaRa). The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene) ...
-
bioRxiv - Biochemistry 2021Quote: ... monoclonal antibody for green fluorescent protein (JL-8; Takara Bio, Kusatsu, Japan; recognizes VC), rabbit anti-GFP (D5.1 Cell Signaling Technology 2956S ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech, dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP fusion proteins were revealed with mouse monoclonal antibody anti-GFP (JL-8, Clontech) used at 1/2000 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... βC1 was fused with binding domain and cloned into pGBKT7 BD (Takara Bio). Plasmids were transformed into AH109 strain as described previously (Gietz and Woods ...
-
bioRxiv - Microbiology 2019Quote: ... Protein bands were detected by Western blot using a commercial 6xHis monoclonal antibody (631212, Clontech) and a goat anti-mouse IgG (H + L)-HRP conjugate (1706516 ...
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and Lamin (LAM) were cloned into the DNA-binding domain vector pGBKT7 (Clontech Matchmaker System). The full-length open reading frame of NAA50 ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Cell Biology 2021Quote: ... was constructed similarly by placing the HRAS-CAAX box motif on the C-terminus of EGFP in the pEGP-C1 vector (Clontech). The RFP-Myo10 construct was prepared by cloning mApple (from Addgene No ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... flanking the site of alterations (HDE-like motifs) were amplified from the genomic DNA using CloneAmp HiFi PCR Premix (Clontech), A-tailed with DreamTaq DNA polymerase and ligated into pGEM-T Easy vector ...
-
bioRxiv - Biochemistry 2021Quote: ... The cell lysate was centrifuged at 40,000 × g for 45 min at 4 °C and the supernatant was loaded onto a cobalt affinity column (Clontech). After washing the column with 20 bed volume of 20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding sequences of Fasciclin 3s were PCR-amplified using 3xFLAG-tag harboring primers from Drosophila cDNA and were ligated into the BamHI/KpnI-digested pUASz1.0 vector [45] using In-Fusion (#Z9648N, TaKaRa). For all isoforms of pAc5-Fasciclin 3::3xFLAG ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Plant Biology 2020Quote: ... The RAV1 motif enriched promoter sequence of each of the gene (Table S1) was cloned in pAbAi bait vector (Clontech, USA) in the upstream of Aureobasidine A ...
-
bioRxiv - Genetics 2021Quote: The coding sequence of the MAR was inserted into the Gal4 DNA-binding domain vector pGBKT7 (Clontech); the coding sequences for full length Nup60 and Nup60(188-388 ...
-
bioRxiv - Biochemistry 2022Quote: ... 9, 11, 13, 20, or 45 (SERF2, C9orf16, C19orf53, C11orf58, BEX3, or SERBP1 respectively) was inserted into pCold I (Takara), together with the client protein ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μL of reaction was added to 50 μL Stellar Competent cells on ice for 30 mins followed by 45 second heat shock at 42 degrees C and resuspended in 500 μL SOC medium (Takara) and placed 1 hour shaking 200 rpm at 30 degrees C ...
-
bioRxiv - Neuroscience 2021Quote: ChIP-seq libraries were generated from ChIP-DNA using a custom Illumina library type on an automated system (Apollo 342, Wafergen Biosystems/Takara, Active Motif). ChIP-seq libraries were sequenced on Illumina NextSeq 500 as single-end 75bp reads (Active Motif).
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal loading of the GFP tagged E2F1 proteins was determined by the GFP antibody (Clontech, lot. 1404005; 1:2000) the secondary antibody anti-rabbit HRP (Na934v ...
-
bioRxiv - Biochemistry 2022Quote: ... and mixed with 50 μL TALON Co2+ resin pre-equilibrated in binding buffer A (Takara Bio, 50% slurry) resulting in a final volume of 100 μL ...
-
bioRxiv - Cell Biology 2019Quote: ... was produced by cloning a gene block (IDT) comprising a human codon optimized C10 Δ(45 - 69) into a YFP-N1 vector (Clontech) digested with NotI and BamHI to replace the YFP insert ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... the TET protein expression in each clone was checked by immunoblotting using TetR monoclonal antibody (Clone 9G9) (Clontech, cat#631131). In addition ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...