Labshake search
Citations for Takara Bio :
51 - 100 of 5594 citations for RNA Amplification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... The remaining 5′ sequence was obtained by 5′-RACE on medaka brain poly(A)+ RNA using the Marathon cDNA Amplification Kit (Takara Bio, Shiga, Japan), essentially as described previously (Kawabata et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Antennal cDNA was synthesized from 1 μg of antennal total RNA using SMARTer™ RACE cDNA amplification kit according to manufacturer’s instructions (Clontech, Mountain View, CA). To obtain full-length coding sequences ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: Reverse transcription and cDNA amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Kusatsu, Shiga, Japan). The resulting amplified cDNA libraries were assessed for DNA concentration using the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: Reverse transcription and cDNA amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Kusatsu, Shiga, Japan). The resulting amplified cDNA libraries were assessed for DNA concentration using the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
IRF1 regulates self-renewal and stress-responsiveness to support hematopoietic stem cell maintenancebioRxiv - Cell Biology 2023Quote: ... cDNA generation and amplification were performed using the SMART-Seq® v4 Ultra® Low Input RNA Kit for sequencing (Takara Bio USA, Inc.). Quality check was performed using High sensitivity D5000 ScreenTape® on TapeStation Analysis Software 3.2 (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: The 5’ end of RiMCO1 was verified by rapid amplification of cDNA ends (RACE) using the SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA), the RiMCO1-specific primer GiFETa.rR (Table S2 ...
-
bioRxiv - Genomics 2021Quote: LR-PCR amplification reaction was performed using PrimeSTAR GXL DNA Polymerase kit (Takara) according to manufacturer”s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs that were used for RACE were synthesised from 1 µg of polyA+ RNA using a SMART RACE cDNA Amplification Kit (Clontech Laboratories, Inc., Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech, Mountain View, CA). For ZK2B10 gene-specific lineage analysis ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by cDNA amplification using the Clontech SMARTer kit (Takara Bio, Mountain View, CA).
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA libraries were prepared using a SMARTer mRNA amplification kit (Clontech, Mountain View, California) and sequencing was performed using the Hi-Seq platform (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA libraries were prepared using a SMARTer mRNA amplification kit (Clontech, Mountain View, California) and sequencing was performed using the Hi-Seq platform (Illumina ...
-
bioRxiv - Immunology 2024Quote: CD8+ T-cells were exposed to the SMARTerTM RACE cDNA Amplification Kit (Clontech/Takara) to identify and annotate ROPN1/B epitope-specific TCRα- and β-chains based on Kunert et al ...
-
bioRxiv - Immunology 2024Quote: CD8+ T-cells were exposed to the SMARTerTM RACE cDNA Amplification Kit (Clontech/Takara) to identify and annotate ROPN1/B epitope-specific TCRα- and β-chains based on Kunert et al ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR amplification of the RNA-Seq library was performed using SeqAmp DNA Polymerase (Takara Bio, cat# 638509). Each library was then purified prior to sequencing using SPRI AMPure Beads (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2022Quote: ... from purified RNA (NucleoSpin RNA kit; Takara). Raw data from the QuantStudio 5 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: PCR amplification was carried out using the Advantage GC 2 PCR Kit (Clontech Catalog #639119), and cloning was carried out using standard procedures (primer sequences are listed below).
-
bioRxiv - Cell Biology 2019Quote: ... followed by PCR-mediated amplification and plasmid insertion with the in-Fusion cloning kit (Clontech). The CLN6ΔL2 construct was obtained by removing the codons for amino acids 155-222 using the Q5 Site-Directed Mutagenesis kit (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed using a One Step PrimeScript RT-PCR Kit (Takara Bio, Otsu, Japan), and the following real-time PCR conditions were applied ...
-
bioRxiv - Plant Biology 2021Quote: ... Subsequent cDNA synthesis and amplification were performed using a SMART-Seq® HT Kit (Takara), and then purified using an Agencourt AMPure Purification Kit (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA synthesis and amplification were performed using the SMART-Seq HT Kit (Takara Bio Inc) and pools of 5 oocytes (~0.1 ng of total RNA ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio). The analysis of the surface markers of the positive cells was performed on FlowJo.
-
bioRxiv - Neuroscience 2021Quote: ... A cDNA library was created with the CellAmp™ Whole Transcriptome Amplification Kit (#3734, Takara Bio) to allow for real-time PCR (qPCR ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the SMARTer RACE cDNA Amplification kit (Clontech, Palo Alto, California, United States). Amplification of the TCRβ VDJ region was performed using previously described primers and amplification protocols(45) ...
-
bioRxiv - Developmental Biology 2022Quote: After amplification of the cDNA library using the Smart-Seq v4 Ultra Low Input Kit (Clontech), the library was prepared using the NEBNext Ultra RNA library prep kit for Illumina (New England Biolabs) ...
-
bioRxiv - Genetics 2022Quote: ... pre-capture amplification was performed using the Takara LA Taq HotStart kit (TaKaRa Bio USA, Inc.) in two ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and genomic DNA amplification was carried out using the PicoPLEX Single Cell WGA kit v3 (Takara) and following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time qPCR amplification was performed using the PrimeScript™ RT-PCR Kit (Takara, Catalog#RR420). Alp ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Pathology 2023Quote: ... Whole genome amplification was performed on the prepared mixture samples with BioSkryb ResolveDNA™ Whole Genome Amplification Kit (BioSkryb Genomics) and Takara PicoPlex WGA v3 kit (Takara) following the manufacture’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted using the nucleospin RNA kit (Takara) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was isolated using NucleoSpin RNA kits (Takara, 740955) and cDNA was synthesized using reverse transcription supermix for RT-qPCR (Biorad ...
-
bioRxiv - Cell Biology 2021Quote: RNA was purified with a NucleoSpin RNA kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: Total RNA was extracted using NucleoSpin RNA Kit (Takara) following the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Amplification and detection were performed using the One Step PrimeScript™ RT-PCR Kit (RR064A, Takara Bio) with the following primers targeting the IAV M segment ...
-
bioRxiv - Microbiology 2023Quote: ... Resulting linear amplification products were pooled and purified using the NucleoSpin Gel and PCR Purification kit (Takara) with modified protocols for ssDNA (1:2 NTI buffer dilution) ...
-
bioRxiv - Evolutionary Biology 2023Quote: The SMARTSeq HT Ultra Low Input Kit was used for full-length cDNA synthesis and amplification (Clontech), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... The SMARTSeq HT Ultra Low Input Kit was used for full-length cDNA synthesis and amplification (Clontech), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was isolated using an RNA isolation kit (TaKaRa) and reverse transcription-PCR (RT-PCR ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was isolated with the RNA Isolation Kit (TaKaRa). To remove any genomic DNA contamination ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted using a NucleoSpin RNA kit (Takara) according to the manufacturer’s protocol ...