Labshake search
Citations for Takara Bio :
101 - 150 of 4813 citations for QuantiFluo Acid Phosphatase Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... the WST-1 Cell Proliferation Assay System (TaKaRa) was used following the manufacturer’s recommendation ...
-
bioRxiv - Cell Biology 2020Quote: ... target proteins were purified from cell lysate by Ni-iminodiacetic acid affinity chromatography (Clontech). However ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplification was tested using gel electrophoresis (1.5% agarose) and products that successfully amplified were cleaned with Exonuclease I and Shrimp Alkaline Phosphatase (Takara, Japan). The cleaned PCR products were cycle-sequenced using a BigDye™ Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA from each candidate cell line was digested to single nucleoside using nuclease P1 (Fujifilm Wako Pure Chemical Corporation) and bacterial alkaline phosphatase (TaKaRa), followed by mass spectrometry analysis ...
-
bioRxiv - Bioengineering 2019Quote: ... The luciferase assay was conducted according to a standard protocol of Ready-To-Grow Dual Secreted Reporter Assay (Clontech Laboratories, Inc., US) except that the amount of substrate was reduced to half of the defined amount.
-
bioRxiv - Cancer Biology 2019Quote: ... The assay was performed following manufacturer’s protocol (Takara, Japan) and relative cytotoxicity was calculated according to the same protocol.
-
bioRxiv - Immunology 2020Quote: ... The protein concentration was determined by Bradford assay (Takara), and the cell lysate was mixed with 4x Laemmli loading buffer containing β mercapto-ethanol ...
-
bioRxiv - Genomics 2024Quote: ... and titer quantified using p24 ELISA antigen assay (Takara). MOI=5 was used to transduce 1x1097 EndoC-βH3 cells in culture media without pen/strep and puromycin.
-
bioRxiv - Genomics 2021Quote: ... 10 ng of cfDNA was dephosphorylated in a 10-μL reaction containing 2.5 μL of 10× TACS buffer and 1 μL of shrimp alkaline phosphatase (Takara Bio Inc.) at 37 °C for 15 min ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... WST-1 assays were performed as per manufacturer’s instructions (Takara) (18).
-
bioRxiv - Plant Biology 2022Quote: Y2H assays were performed according to the manufacturer’s protocol (Clontech). For Y2H screening ...
-
bioRxiv - Plant Biology 2023Quote: Yeast two-hybrid assays were performed using strain AH109 (Takara). Vectors pGADT7 and pGBKT7 were sequentially transformed into this strain ...
-
bioRxiv - Cell Biology 2023Quote: ... secreted embryonic alkaline phosphatase (SEAP) activity and TGF-β concentration were determined using the Great EscAPe® SEAP (631738, TaKaRa Bio, Kusatsu, Japan) chemiluminescence kit to quantify SEAP activity (excitation wavelength 360 nm ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Pseudotyped viruses were quantified with a p24 assay (Takara Bio #632200) per manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Y2H assay was performed according to the Yeast Protocols Handbook (Clontech) using the Y2H Gold yeast reporter strain (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: Y1H assay was conducted according to protocol (Clontech, cat. No. 630491). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assay was performed according to protocol (Clontech, cat. No. 630489). Since BcICE1 self-activates ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed using the MatchmakerTM Two-Hybrid System (Clontech). Bait (pGBKT7 ...
-
bioRxiv - Microbiology 2023Quote: ... SEAP activity was quantified using the Great EscAPe SEAP assay (Clontech). Fluorescence was read on a Filtermax F5 plate reader (Molecular Devices).
-
bioRxiv - Plant Biology 2024Quote: ... Yeast two-hybrid assays were performed using yeast strain AH109 (Clontech) following standard procedures (Yeast Protocols Handbook PT3024-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Plant Biology 2021Quote: Cell viability assays were performed by using either Y2HGold yeast strains (Clontech) containing a pBridge bait vector or diploid yeast strains generated by mating a Y2HGold strain containing a bait vector with a Y187 strain (Clontech ...
-
bioRxiv - Plant Biology 2021Quote: Y2H assays were performed using the Matchmaker™ Two-Hybrid System (Clontech). Bait (pGBKT7 ...
-
bioRxiv - Plant Biology 2021Quote: Y2H assays were performed using the Matchmaker GAL4 two-hybrid system (Clontech). The full-length and/or partial (RING ...
-
bioRxiv - Immunology 2020Quote: ... The PCR assays were run using LA Taq polymerase (Takara Bio, TAKRR002) with the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µL of premix WST-1 cell proliferation assay (Takara Bio, Inc.) was added to each well and the plate was incubated for an additional 2 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative α-galactosidase assay was also performed according to manufactural instruction (Clontech). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... The tetrazolium salts from Premix WST-1 Cell Proliferation Assay System (TAKARA) are cleaved by mitochondrial dehydrogenase in viable cells to produce formazan dye ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... The Y2H assays were performed in the Y2H Gold strain (PT4084-1, Takara 630489 ...
-
bioRxiv - Plant Biology 2020Quote: Y1H assays were performed using a Matchmaker™ Gold Y1H System (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Yeast two-hybrid assay was performed using the Matchmaker Two-Hybrid System (Clontech) by following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cellular proliferation was measured with a WST–1 cell proliferation assay system (Takara). WST–1 reagent was added to each well and incubated for 2 hours at 37 °C ...
-
bioRxiv - Genetics 2020Quote: Y2H assay was performed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... VLP were quantified by a LFA assay for HIV p24 (GoStix Plus, Takara). In this case the number of virions per volume is calculated by the approximate stoichiometry of p24 in VLP (∼2000/virion) ...
-
bioRxiv - Cell Biology 2024Quote: Y2H assays were carried out using the Matchmaker two-hybrid system (K1605, Clontech). One of the baits pGBT9 ...
-
bioRxiv - Bioengineering 2024Quote: ... VLP were quantified by a LFA assay for HIV p24 (GoStix Plus, Takara). In this case the number of virions per volume is calculated by the approximate stoichiometry of p24 in VLP (∼2000/virion) ...