Labshake search
Citations for Takara Bio :
201 - 250 of 339 citations for Prestained SDS PAGE Standards Single Color since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... DNA ligation was done using standard ligation techniques (Takara DNA Ligation kit ver.2.1, Takara, Otsu, Japan). For the transformation ...
-
bioRxiv - Biochemistry 2022Quote: ... aIF1A was purified as described (24) except that a standard affinity chromatography step on Talon resin (Clontech) was added to the original protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Western blotting was performed using standard procedures with the following primary antibodies: JL-8 monoclonal antibody (Takara) for GFP variants ...
-
bioRxiv - Molecular Biology 2020Quote: DNA ligation was performed using standard ligation techniques (Takara DNA Ligation kit ver. 2.1; Takara, Otsu, Japan). For transformation ...
-
bioRxiv - Bioengineering 2020Quote: Expression constructs were cloned using standard PCR methods and In-Fusion® HD Cloning (TaKaRa Bio Europe). Primers were ordered from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcriptase-containing pseudoviral particles and recombinant reverse transcriptase standard of known concentrations (TAKARA, Cat. No. RR047A) were 10-timed diluted with nuclease-free water (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... a single-stranded donor for homologous recombination was generated using the Guide-it Long ssDNA Production System (Clontech). The gRNA ...
-
bioRxiv - Cell Biology 2022Quote: cDNA was generated from single cells in the 96-well plate using the SmartSeq v4 kits (Takara Bio) using 1/4th volume reactions dispensed using a Mantis dispenser (Formulatrix) ...
-
bioRxiv - Plant Biology 2021Quote: ... Each of the 27 libraries were sequenced on a single SMRT cell (1M,v3 for Teloprimev2 and Clontech) on a PacBio Sequel machine using a 10hr (v3 ...
-
bioRxiv - Microbiology 2020Quote: ... converted to single stranded cDNA and amplified using the SMARTer PCR cDNA Synthesis Kit (Takara Bio, Kusatsu, Japan), and IsoSeq libraries were constructed with equimolar cDNA fractions (0.5X and 1X ...
-
bioRxiv - Pathology 2022Quote: ... Single-stranded cDNA was reverse transcribed using Prime Script RT Master Mix (Perfect Real Time) (Takara Bio Inc.), and used for subsequent real-time PCR reactions ...
-
bioRxiv - Immunology 2022Quote: ... Cells were lysed using Takara Bio Single Cell Lysis Buffer containing a recombinant RNase inhibitor (Takara Bio Inc.) then snap frozen ...
-
bioRxiv - Neuroscience 2019Quote: ... Single stranded cDNA from the total RNA was synthesized with a RT-PCR kit (Clontech, Mountain View, CA) according to the kit’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... single nuclei were sorted into 8-well strip tubes containing 11.5μl of SMART-seq v4 collection buffer (Takara) supplemented with ERCC MIX1 spike-in synthetic RNAs at a final dilution of 1×10-8 (Ambion) ...
-
bioRxiv - Neuroscience 2023Quote: ... by dispensing individual cells in 5 nL drops directly into 3 µL ice-cold single cell lysis buffer (scLB, 0.134% Triton X-100 [Sigma], 0.5 U/µL recombinant RNase inhibitor [Takara, 2313B] ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2024Quote: Single or multiple DNA fragments were cloned into binary vector using In-Fusion HD Cloning Kit (Clontech, USA). Briefly ...
-
bioRxiv - Developmental Biology 2024Quote: Single-cell cDNA synthesis was performed using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) according to the manufacturer’s protocol with some modifications as previously described17 ...
-
bioRxiv - Cell Biology 2024Quote: ... 7 μg of lentiviral vectors was mixed with a Lenti-X packaging (VSV-G) single shots tube (Clontech) in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90% ...
-
bioRxiv - Bioengineering 2024Quote: ... The two fragments were assembled in a single In-Fusion reaction (In-Fusion HD Cloning Kit, Takara, 639650), and the PCR-derived regions of the resulting plasmids were confirmed by sequencing.
-
bioRxiv - Molecular Biology 2019Quote: ... 1.8 µl of reaction stop solution containing 5.3% SDS and 6.6 mg/ml proteinase K (Takara) was added and the sample was incubated for 60 min at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.8 μl reaction stop solution containing 5.3% SDS and 6.6 mg/mL proteinase K (9034, Takara) was added and the sample was incubated for 60 min at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... and then cloned into pENTR/D/SD entry vector using the In-Fusion cloning kit (Takara). Inserts of all plasmids were sequenced by Macrogen ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids were constructed using standard molecular biology methods including polymerase chain reaction (PCR) and In-fusion cloning (Clontech). Mutations for specific residues were introduced by overlap-extension PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were lysed and quantitative β-galactosidase assay was performed using ONPG substrate following standard protocols (Clontech Laboratories). For two-hybrid experiments in meiotic conditions ...
-
bioRxiv - Genetics 2019Quote: ... all other experiments with yeast were carried out according to standard protocols (Clontech Yeast Protocol Handbook, PT3024-1).
-
bioRxiv - Microbiology 2022Quote: All plasmid inserts were amplified by PCR using standard PCR conditions and the CloneAmp HiFi PCR premix (Takara). Following a PCR purification step (QIAquick PCR purification kit) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmid constructions were performed with standard restriction enzyme cloning or In-fusion HD Cloning kit (Takara Bio USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were lysed and quantitative β-galactosidase assay was performed using ONPG substrate following standard protocols (Clontech Laboratories).
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... DNA was purified using the standard phenol-chloroform extract method and subjected to DNase I (Takara, 2270 B) treatment and reverse transcription for DRIPc-seq library construction ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA was reverse-transcribed to single-stranded cDNA using the AMV Reverse Transcription System (Takara, Dalian, Liaoning, China). Then ...
-
bioRxiv - Genomics 2020Quote: ... using a Multi Sample Nano Dispenser (MSND, SMARTer™ ICELL8® Single-Cell System, Takara Bio USA, CA, USA). Chip wells were sealed using SmartChip Optical Imaging Film (Takara Bio USA ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were converted to cDNA and amplified using Smart-Seq V4 Ultra Low Input RNA Kit (Takara Bio). The cDNA output was then processed with Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... prior to cells being fully resuspended to a single-cell suspension in 2mL NDiff227 with a 1mL pipette (Takara). Using a multichannel pipette ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 100 microglia from each region were collected in 5 μL single-cell lysis buffer (635013, Takara), and flash-frozen on dry ice.
-
bioRxiv - Neuroscience 2023Quote: ... Plasmid DNA used to generate lentiviral particles were transfected into HEK293 cells using LentiX single-shot VSV-G (Takara) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: Single or multiple DNA fragments were cloned into fungal transformation vector using In-Fusion HD Cloning Kit (Clontech, USA). Briefly ...
-
bioRxiv - Bioengineering 2021Quote: Plasmids were constructed by standard molecular biology methods such as polymerase chain reaction (PCR) and In-fusion cloning (Clontech). Mutations for specific amino acids were generated by overlap-extension PCR ...
-
bioRxiv - Bioengineering 2024Quote: ... All the other plasmids used in this study are cloned by following the standard protocol of Infusion HD (Takara).
-
bioRxiv - Microbiology 2019Quote: ... We added 5 μl of transformants (107/mL) on SD/–Leu/–Trp (Clontech, Mountain View, CA, USA) and SD/–Ade/– His/–Leu/–Trp (3 mM 3-AT ...
-
bioRxiv - Bioengineering 2020Quote: ... and then medium was replaced with liquid medium containing minimal SD/Gal/Raf base (Clontech, cat. 630420), –His/–Trp/–Ura dropout supplement ...
-
bioRxiv - Bioengineering 2020Quote: ... Transformed strains were grown at 30 °C on agar plates containing minimal SD base (Clontech, cat. 630411) and –His/–Trp/–Ura dropout supplement (Clontech ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech) supplemented with 40mg/LX-α-gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside ...
-
bioRxiv - Genomics 2021Quote: The NucBlue and DAPI co-stained single-nuclei suspension (60□cells/µl) was distributed to eight wells of a 384-well source plate (Takara) and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were sorted into 96-well plates containing 4uL lysis buffer containing 4U Recombinant RNase Inhibitor (Takara Bio 2313B), 0.05% Triton X-100 ...
-
bioRxiv - Pathology 2020Quote: ... Single stranded cDNA was synthesized with the oligo(dT) primer using PrimeScript™ RT reagent Kit with gDNA Eraser (Takara), the obtained cDNAs were analyzed by real-time PCR ...
-
bioRxiv - Physiology 2021Quote: ... as well as the left and right homology arms were assembled and cloned into SmaI-digested pBluescriptII SK(-) in a single enzymatic reaction using the In-Fusion Cloning Kit (TAKARA). gRNA vectors were constructed in pDCC690 ...