Labshake search
Citations for Takara Bio :
51 - 100 of 387 citations for Phospho Tyrosine Rabbit Polyclonal HRP labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... HA-tag polyclonal Antibody (631207) was from Clontech.
-
bioRxiv - Cell Biology 2019Quote: ... The antibody against GFP (polyclonal) was from Takara Bio Inc ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6xHN Polyclonal Antibody (1:2000, Takara, CA, USA) at 4°C for overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... and end-labeled by T4 polynucleotide kinase (Takara Bio) and [γ-32P]-ATP (PerkinElmer) ...
-
bioRxiv - Neuroscience 2023Quote: ... and mCherry (anti-dsRed polyclonal, 1:1000; Clontech, 632496). Sections were then washed in phosphate buffered saline (PBS ...
-
bioRxiv - Genomics 2019Quote: ... Human Universal Reference Total RNA (Takara Bio/Clontech, labeled A), a mixture of 23 normal human tissues (including brain ...
-
bioRxiv - Genomics 2019Quote: ... Human Universal Reference Total RNA (Takara Bio/Clontech, labeled A), a mixture of 23 normal human tissues (including brain ...
-
bioRxiv - Molecular Biology 2019Quote: ... and fluorescent double-labeled probes were synthesized by Takara (Japan). All of the DNA and RNA sequences are provided in Table S1 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-dsRed (1:1000, Living Colors DsRed Polyclonal Antibody, Takara). After rinsing 5x 10 min each in PBST ...
-
bioRxiv - Physiology 2020Quote: ... followed by incubation with DsRed Polyclonal Antibody (Takara Bio # 632496) overnight in PBST (0.2% ...
-
bioRxiv - Neuroscience 2023Quote: ... and Living Colors® DsRed Polyclonal Antibody (1:200, Clontech). BrdU ...
-
bioRxiv - Plant Biology 2023Quote: ... Probes were detected with sensitive HRP substrates (Takara), and an iBrightTM CL750 Imaging System.
-
bioRxiv - Developmental Biology 2022Quote: ... and/or mCherry (Living Colors DsRed Polyclonal Antibody #632496, Takara, Japan) after in situ hybridization were carried out as described in (Chen Q et al. ...
-
bioRxiv - Immunology 2021Quote: ... or Western BLoT Ultra Sensitive HRP Substrate (Takara Bio).
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-linked (1:2000, Takara, japan, Cat#T7122A-1);
-
bioRxiv - Molecular Biology 2021Quote: ... HRP-linked (1:2000, Takara, Japan, Cat# T7122A-1).
-
bioRxiv - Plant Biology 2022Quote: ... Bound proteins were detected using Hyper HRP Substrate (Takara). PtIns(3,5)P2 Grip protein (P-3516-3-EC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and developed using Western BLoT Chemiluminescent HRP Substrate (Takara). The chemiluminescent images were observed using FUSION FX (Vilber ...
-
bioRxiv - Biochemistry 2022Quote: ... probes labeled with [α-32P] dCTP by random priming (Takara, cat# 6045) were hybridized to the membrane in PerfectHyb Plus Hybridization buffer (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Cell Biology 2020Quote: ... then transferred to drop of GFP polyclonal antibody (TaKaRa, Cat. No. 632592) at 1:50 for 1 h and subsequently in second antibody conjugated with 18-nm gold particles (Jackson ...
-
bioRxiv - Microbiology 2021Quote: ... or Western BLoT Ultra Sensitive HRP Substrate (Takara, Cat# T7104A) according to the manufacturers’ instruction ...
-
bioRxiv - Genetics 2022Quote: ... ISH was performed using digoxigenin-labeled oligonucleotide lnc-WAL probe (TCAGCACTGTCATCATTACATT) (Takara, Japan) according to previous literature(Liu et al. ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Neuroscience 2021Quote: ... using anti-DsRed (1:500; RRID:AB_10013483; Living Colors DsRed polyclonal; Takara Bio USA). Tissues were rinsed ...
-
bioRxiv - Neuroscience 2023Quote: ... DCX: doublecortin (C-18) goat polyclonal IgG (1:200, Takara Bio, Cat# 632496). NeuN ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-labeled PACSIN2 was prepared by subcloning PACSIN2 cDNA into pmCherry-C1 vector (Clontech), in which the GFP in pEGFP-C1 was replaced with mCherry ...
-
bioRxiv - Neuroscience 2019Quote: ... or IMPA1L 120nt fragment were labeled using Random Priming Labeling Kits (Takara or Roche) and [α−32P] dCTP ...
-
bioRxiv - Immunology 2023Quote: ... Probes (50 ng) were labeled with 32P using the Ladderman DNA labeling kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... 32P-labeled dsRNAs were synthesized using the in vitro T7 Transcription kit (Takara Bio) with [α-32P]-UTP (PerkinElmer ...
-
bioRxiv - Cancer Biology 2020Quote: ... phospho-specific mutant constitutively active NFATC4 17 was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4 ...
-
bioRxiv - Neuroscience 2023Quote: ... guinea pig polyclonal anti-RAX (1:200; M229 Takara Bio Europe Ab, Goteborg, Sweden); rabbit polyclonal anti-activated caspase 3 (AC3 ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were probed with γ32P 5’ end-labeled oligonucleotide (Table S3) in ExpressHyb solution (Clontech) and scanned after exposition with Typhoon FLA 9500 scanner (GE Healthcare).
-
bioRxiv - Immunology 2021Quote: ... immunoreactive bands were visualized using Western BLoT Quant HRP Substrate (Takara Bio) or Western BLoT Ultra Sensitive HRP Substrate (Takara Bio).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The membrane was incubated with Western BLoT Chemiluminescence HRP Substrate (TaKaRa Bio), and membrane image was captured using a chemiluminescent imaging system LuminoGraph I (ATTO ...
-
bioRxiv - Immunology 2019Quote: ... transferred to nitrocellulose and Western blotting performed with monoclonal α6xHis/HRP (Clontech) or αTEP1.
-
bioRxiv - Microbiology 2023Quote: ... Chemiluminescence was detected using Western BLoT Ultra Sensitive HRP Substrate (T7104A, Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-dsRed (Clontech) 1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (TaKaRa Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (Clontech), guinea-pig anti VGLUT1 (Synaptic Systems ...
-
bioRxiv - Developmental Biology 2020Quote: ... dissected calvaria from 9SL or 11SL fish were labeled with antibodies against mCherry (Takara, 1/100), GFP (Roche ...
-
bioRxiv - Bioengineering 2019Quote: ... The ultrasensitive HRP substrate used for Western blotting was from TaKaRa (Shiga, Japan). The CM5 Sensor Chip ...
-
bioRxiv - Microbiology 2021Quote: ... The protein bands were visualized using the Western BLoT Hyper HRP Substrate (TAKARA) and exposed using a Chemiluminescence Imaging System (Fusion Solo S ...
-
bioRxiv - Cell Biology 2021Quote: The membrane was then incubated with Western BLoT Hyper HRP Substrate (Takara: T7103B) for chemiluminescence detection ...
-
bioRxiv - Immunology 2022Quote: ... The signal was detected using the Western Blot Ultra-Sensitive HRP Substrate (Takara) and imaged using the Fusion FX Imaging system (PeqLab Biotechnologie).
-
bioRxiv - Cell Biology 2021Quote: ... 1982) or a commercial antibody against dsRed that detects mCherry (Living Colors DsRed Polyclonal Antibody, Clontech). After 3 consecutive 5-min washes in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... An oligonucleotide probe against snoRNA58 labeled with [γ-32P] ATP by T4 polynucleotide kinase (Takara, cat# 2021A) was used as a loading control ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-dsRed (Takara Bio) 1:500 or chicken anti-GFP (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (Takara #632496), mouse anti-Actin (Sigma #A4700 ...