Labshake search
Citations for Takara Bio :
1 - 50 of 332 citations for Phospho Tau antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... A398P and T435P mutations (pDONR221-AR-AD-TAU-5) using KOD polymerase (Takara Bio) and the following primer pair.
-
bioRxiv - Neuroscience 2023Quote: ... Tau was then purified batchwise from the supernatant using TALON Metal Affinity Resin (TaKaRa, 635502) according to the vendor’s instructions ...
-
bioRxiv - Microbiology 2021Quote: For the generation of a tau-P301S expression plasmid the multiple cloning site (MCS) of the pLHCX vector (Clontech) was modified by inserting a synthetic MCS-sequence (ACCGGTCTCGAGGCGGCCGCGGCCAAAAAGGCCGGATCCGTTAACACCAAAAA ATGGCACGTGGCCGGCACGCGTGGGCCCGTCGAC ...
-
bioRxiv - Microbiology 2021Quote: ... SH-SY5Y cells constitutively expressing human tau 2N4R-P301S were generated by retroviral infection of pLHCX-mod-MCS-tau-P301S according to the manufacturer’s protocol (Clontech)
-
bioRxiv - Neuroscience 2020Quote: ... And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara). The resulting constructs were fully sequenced to confirm the absence of unwanted substitutions.
-
bioRxiv - Neuroscience 2020Quote: ... And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara). The resulting constructs were fully sequenced to confirm the absence of unwanted substitutions.
-
bioRxiv - Cancer Biology 2020Quote: ... phospho-specific mutant constitutively active NFATC4 17 was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The primary antibody rabbit anti-human Cas9 Polyclonal Antibody (Clontech) was diluted 1 ...
-
bioRxiv - Microbiology 2022Quote: ... monoclonal antibody (Clontech) and peroxidase-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Microbiology 2023Quote: ... anti-GAPDH antibody (Clontech) at a 1/2500 dilution ...
-
bioRxiv - Genetics 2019Quote: ... Antibodies used were GAL4 AD Mouse Monoclonal Antibody (Takara Bio USA, Inc. #630402), GAL4 DNA-BD Mouse Monoclonal Antibody (Takara Bio USA ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubation with the primary antibody (polyclonal rabbit anti-dsRed antibody, 632496, Clontech, dilution 1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... SMAD2 #3122 and SMAD3 #9523 antibodies (Cell Signalling Technology) and anti-FLAG antibody (Clontech). Horseradish peroxidase-conjugated secondary antibodies and anti-rabbit and anti-mouse antibodies were acquired from Molecular Probes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The following antibodies were used: Anti-GFP antibody (JL-8 from Takara, Shiga, Japan), anti-Flag antibody (M2 from Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-GFP antibody (Clontech) for 1 hour at room temperature followed by a second incubation with HRP-conjugated secondary antibody (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal Antibody (JL-8) (Clontech). Anti-mouse IgG was used as a secondary antibody.
-
bioRxiv - Cell Biology 2021Quote: ... 1982) or a commercial antibody against dsRed that detects mCherry (Living Colors DsRed Polyclonal Antibody, Clontech). After 3 consecutive 5-min washes in PBS ...
-
bioRxiv - Plant Biology 2019Quote: Primary antibodies were monoclonal antibodies from mouse: α-GFP (JL-8, 1:5000, Takara, Shiga, Japan) or rat ...
-
bioRxiv - Neuroscience 2023Quote: ... a mix of an mCherry-DsRed rabbit polyclonal antibody (Living Colors-Clontech Antibody 632496, 1:1000) and a mouse monoclonal antibody against oxytocin (P38 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... combined with TaqStart Antibody (639250, Takara Bio Europe ...
-
bioRxiv - Microbiology 2019Quote: ... Rabbit anti-GFP antibody (Clontech #632377) was used at 1:5,000 dilution ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-mCherry antibody (#Z2496N, TaKaRa), or a horseradish peroxidase-conjugated anti-α-tubulin antibody (#HRP-66031 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.22 µg TaqStart Antibody (Clontech). 45-50 cycles of amplification were performed on a Bio-Rad C1000 thermocycler and the resulting product visualized with ethidium bromide on a 2% agarose gel.
-
bioRxiv - Plant Biology 2022Quote: ... The anti-GFP antibody (TaKaRa, 632381), the anti-LhcB2 antibody (Agrisera ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti GFP antibody (Clontech, lot. 1404005) and anti-H3 (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: ... Monoclonal Antibody (JL-8) (632381; Clontech) in 1:2,000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... Western blotting was performed using standard procedures with the following primary antibodies: JL-8 monoclonal antibody (Takara) for GFP variants ...
-
bioRxiv - Immunology 2023Quote: Primary antibodies used for imaging include Living Colors anti-DsRed Rabbit Polyclonal Pan Antibody (1:500; TaKaRa), Chicken Polyclonal anti-GFP (1:300 ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... a commercial anti-GFP primary antibody (Clontech living colors full-length polyclonal antibody ...
-
bioRxiv - Developmental Biology 2019Quote: ... A monoclonal GFP antibody (JL-8; Clontech) and a monoclonal HA antibody (sc-7392 ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies anti-HA.11 (Clontech, 631207) or anti-A3H were used at a dilution at 1:500 and 1:50 ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP monoclonal antibody (Takara, # 632375; 1:2,000), Bip2 antibody (Agrisera ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Antibodies used were: anti-dsRed (Clontech, 632496) 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP antibody (Clontech, rabbit, 1:2000), anti-Ago1 antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody (cat # 632380, 1: 2,000, Clontech) and horseradish peroxidase (HRP)-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Genomics 2023Quote: ... Antibody list: FOXG1 (rabbit, 1:200, Takara) and PAX6 (mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GFP antibody (JL8) was from Clontech, and anti-Cdc37 antibody (E-4 ...
-
bioRxiv - Genetics 2023Quote: ... or mouse α-GFP antibody (632381, Takara) were diluted 1:2000 in Odyssey Blocking Buffer (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... primary antibody was prepared in PBS containing 1% non-fat milk using anti-hexahistidine antibody (Takara Bio, catalog #631212) at a dilution of 1:3000 ...
-
bioRxiv - Immunology 2021Quote: ... The following primary antibodies were used in this study: Living colors DsRed Polyclonal antibody (Rabbit, 1:300, Takara Bio #632496); FITC Anti-mouse Ki67 (1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were subjected to 4-20% SDS-PAGE and analyzed by immunoblotting with the following primary antibodies: anti-GFP mouse monoclonal antibody (JL-8, Takara), GFP rabbit polyclonal antibody (PABG1 ...
-
bioRxiv - Immunology 2019Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... The anti-GFP antibody was purchased from Clontech. The anti-CPY and anti-Pgk1 antibodies were from Molecular Probes ...
-
bioRxiv - Biochemistry 2020Quote: ... HA-tag polyclonal Antibody (631207) was from Clontech.
-
bioRxiv - Microbiology 2020Quote: ... then incubated with antibody against c-Myc (Clontech) in lysis buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Microbiology 2022Quote: ... Western blots using Anti-His primary antibody (Clontech) (1:4000 dilution ...