Labshake search
Citations for Takara Bio :
1 - 50 of 560 citations for Oxychlordane Unlabeled 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 2 ug/mL doxycycline (Clontech, Cat. No. 631311). i3Neurons were then fed three times a week by half media changes ...
-
bioRxiv - Neuroscience 2020Quote: ... and pHelper (Cellbiolabs VPK-401) (per 15 cm plate, 15.5 ug, 21.0 ug, and 33.4 ug respectively) using Xfect (Clontech 631318) transfection reagent ...
-
bioRxiv - Immunology 2022Quote: ... OVA and GFP expression was induced by adding 1 ug/ml doxycycline (Takara, 631311) to the culture medium ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 ng/ml doxycycline (Clontech) was added 24 hours post-transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 U/mL RNase inhibitor (TAKARA)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 U/ml RNase inhibitor (TAKARA), Complete Protease Inhibitor EDTA-free in nuclease-free water) ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Cell Biology 2023Quote: ... Flow-sorted cells were cultured in ex vivo GT media in a 96 well flat bottom plate coated with 33.3 ug/ml of Retronectin (Takara). The 62 hr protocol consisted of pre-stimulation in GT media (24 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 100 ng/ml Doxycycline (Clontech #631311) and 0.1 μl RNAiMAX per pmol siRNA (Thermofisher Scientific #13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... or 100 ng mL-1 anhydrotetracycline (aTc) (Takara), as necessary.
-
bioRxiv - Pathology 2020Quote: ... 100 μg/ ml Dnase I (Cat.#2270A, TaKaRa) and 100 μg/ml Rnase A (Cat.#AC118 ...
-
bioRxiv - Neuroscience 2023Quote: Five ug of total RNA from human total brain (Clontech) was reverse transcribed using GeneRacer oligo-dT primer and SuperScript III First-Strand Synthesis System (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were transduced on RetroNectin (100 µg/mL; Takara)-coated plates at an MOI of 5 and the transduced population was enriched by puromycin (3 µg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 ug total RNA and PrimeScript RT Master Mix (Takara, Japan) was used for reverse transcription in a SimpliAmp Thermal Cycler (Life technologies ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 2 ug Retronectin (TaKaRa Cat. no. T110A), 1 ug anti-mouse CD11a (LFA1) ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatant was collected two and three days after transfection of GP2-293T cells and concentrated onto wells of a 6 well plates coated with Retronectin (Takara Bio, 5 ug/ml) by spinning at 2500g for 90 minutes at 32° C ...
-
bioRxiv - Immunology 2023Quote: ... in 6-well plates pre-coated with 15 ug retronectin (Takara T100A). Plates were spinfected by centrifugation at 2500 rpm 32C for 90 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 ug RNA was reverse transcribed using a PrimeScript RT-PCR kit (Takara Bio) by following the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Template DNA was extracted from antenna or leg of the individuals by placing them in 50 μL of 5% Chelex solution (Chelex 100, 100–200 mesh, Bio Rad) and 0.5 μL of proteinase K (20mg/mL, Takara Bio Inc.), then incubating for 24 h at 56 °C and 5 min at 95 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Expression of the reporter was induced with 100 ng/mL anhydrotetracycline (Clontech, #631310) for 6-8 hours ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA (150 ug) was treated using the OligotexTM -dT30
mRNA Purification Kit (Takara Bio). The purified poly(A)+ RNA was reverse-transcribed with oligo(dT ... -
bioRxiv - Developmental Biology 2021Quote: ... The cDNA was synthesized with 1 ug total RNA using the PrimeScriptTM RT Reagent Kit with gDNA Eraser (TaKaRa). qRT-PCR was performed using a qTOWER3G system (analytikjena ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 ug of RNA was reverse-transcribed into cDNAs using the Prime Script RT Reagent Kit (Takara, RR037B) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... The RNA (1 ug/sample) was reverse transcribed into cDNA and Q-PCR was performed using a SYBR Green PCR kit (Takara) in a Light Cycler (Eppendorf) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Aliquots of 2.0 ug of the total RNA were collected for cDNA synthesis by using Clontech Oligo dT cDNA synthesis kit (Takara Bio USA ...
-
bioRxiv - Molecular Biology 2021Quote: ... for at least 20 min, followed by 5 ug/cm2 of laminin (Fisher, CB40232) resuspended in basal RHB-A medium (Takara, Y40000). After washing off this treatment ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were diluted 30 or 60 times in 100 µl mTeSR with 1:1000 Y-27632 (STEMCELL, 72302) and 2µg/ml doxycycline (Clontech, 631311) and the cell suspension was added to a well containing the transfection complexes ...
-
bioRxiv - Plant Biology 2022Quote: ... His (SD/-Trp/-Leu/-Ade/-His) and with sprayed 100 µl of 4 mg/ml X-α-Gal (Takara Bio, CA, USA) in dimethylformamide on plates (SD/-Trp/-Leu/-His/X-α-Gal) ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: Quadriceps muscles were dissected and snap-frozen in liquid nitrogen and homogenized in RNAiso plus Reagent (TAKARA, 1 mL/100 mg tissue) to isolate total muscle RNA as per the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 ng pEGFP-N1 (Clontech), and 100 ng modified pLL3.7 vector containing a puromycin resistance gene ...
-
bioRxiv - Biophysics 2020Quote: ... CV = 100 μL (Takara Bio) in a Micro Bio-Spin Chromatography Column equilibrated with CoWB ...
-
bioRxiv - Neuroscience 2020Quote: ... and STEM121 (1:100, Takara) antibodies were used for detecting human cells ...
-
bioRxiv - Immunology 2023Quote: ... 100 units RNAse-Inhibitors (Takara)) for 20 min at 4°C in a rotating mixer ...
-
bioRxiv - Bioengineering 2023Quote: ... Stem101 (Takara Y40400; 1:100), Stem121 (Takara Y40410 ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 ng pEGFP-N1 (Clontech). (4 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (1:100, Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... 100 µL of Fruit-mate (Takara) and 4.5 µL of β-mercaptoethanol (Wako ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of the above mixtures were loaded on 100 µL of TALON resin (Takara Bio, USA), in 200 µL thin-walled PCR tubes and incubated for 5 min at room temperature ...
-
bioRxiv - Developmental Biology 2019Quote: ... Rabbit anti-Dsred (1:100; Takara, 632496), Mouse anti-Trio (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-dsRed (1:100, Clontech, 632496), Rabbit anti-Neuroglian (1:50 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Living Colors anti-DsRed (Clontech #632496, 1:100), anti-RFP (Novus Biologicals #42649) ...
-
bioRxiv - Developmental Biology 2019Quote: ... mCherry (Takara Bio or Novus Biologicals, 1:100). For Snail/Dach double immunostaining ...
-
bioRxiv - Developmental Biology 2021Quote: ... to detect mOrange (rabbit, Clontech 632496, 1:100). The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2021Quote: ... Rapamycin analogue linker drug (AP21967, Clontech, 100 nM, 3hrs), SAR405 (Millipore Sigma ...