Labshake search
Citations for Takara Bio :
101 - 150 of 796 citations for Oropouche Virus Gc Protein Mouse Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus titer was measured using Lenti-X GoStix Plus assay kit (Takara Bio, 631280).
-
bioRxiv - Cancer Biology 2023Quote: ... Lenti-X GoStix Plus were then used to determine virus titer (Takara Bio cat#631280). For lentiviral infection ...
-
bioRxiv - Microbiology 2024Quote: ... A3 encapsidation was determined by concentrating the virus containing supernatant using Retro-X Concentrator (Clontech) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Virus was plated on non-tissue culture treated 24-well plates precoated with retronectin (TaKaRa) overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Virus titer was measured by using Lenti-X p24 Rapid Titer Kit (Cat #022261, Takara).
-
bioRxiv - Immunology 2024Quote: ... The virus particles were then purified using the Aneno-X Maxi Purification Kit (Takara Bio), and the buffer was replaced with 1X Formulation Buffer containing 2.5% glycerol (w/v) ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus was collected at 48 hours and 72 hours and concentrated with Lenti-X Concentrator (Clontech). The Virus was resuspended in DMEM and stored at -80C.
-
bioRxiv - Cell Biology 2019Quote: ... after which virus-containing supernatants were harvested and concentrated ∼40-fold using Lenti-X Concentrator (Clontech) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was then quantified using the Lenti-X™ p24 Rapid Titer Kit (Takara Bio) and aliquots were frozen at −80° C for future use.
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... The virus supernatant was harvested 72 hrs post-transfection and concentrated using Lenti-X Concentrator (Clontech). Panc1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Immunology 2020Quote: ... Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).
-
bioRxiv - Immunology 2020Quote: ... Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).
-
bioRxiv - Microbiology 2023Quote: The virus RNA in the cell or culture supernatant was extracted with nucleospin RNA plus (TaKaRa) and quantified by RT‒qPCR using Primer/Probe N2 (NIHON GENE RESEARCH LABORATORIES ...
-
bioRxiv - Immunology 2022Quote: ... Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).
-
bioRxiv - Immunology 2022Quote: ... Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).
-
bioRxiv - Plant Biology 2023Quote: ... under the control of cauliflower mosaic virus 35S promoter in the binary vector pBI121 (Clontech, USA) was transferred into Agrobacterium tumefaciens strain GV3101 and used to transform Arabidopsis by floral dip method and tobacco plants by leaf disk method (Horsch et al. ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was purified from the medium with NucleoSpin® RNA Virus kit (U0956A, Takara Bio Inc.) by following the manufacture’s instruction and subjected to RT-qPCR with the primer pairs for EGFP (5′-CAAGCTGACCCTGAAGTTCATCTG-3′ and 5′-TTGAAGAAGTCGTGCTGCTTCATG-3′ ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus (AAV) cell-lysates were produced using the AAVpro Purification Kit (All Serotypes) (Takara) with slight modifications ...
-
bioRxiv - Developmental Biology 2021Quote: DN-Brn2 expression vector was generated by PCR amplification of Brn2 DBD and addition of NES sequences using primers ATC ATC GAA TTC GAG AGT CAT GCT TCA ACT TCC TCC TCT TGA ACG CCT TAC CCT TGG AGG AGG AGG ACC GGG CCA CCC AGG CGC GCA C and GAT GAT GGA TCC CCA AGG GTA AGG CGT TCA AGA GGA GGA AGT TGA AGT CCT CCT CCT CCA CCC CCA TAC ACA TCC TCG GC and mBrn2 template plasmid (Sugitani et al. 2002) into mCherry N1 (Clontech). Subsequently ...
-
bioRxiv - Genetics 2023Quote: ... The whole fkbA locus from the FK506 resistant isolates was amplified using primers JOHE52223 and JOHE52224 and LA Taq DNA polymerase for long-range PCR with GC Buffer I (Takara). PCR conditions were optimized for long fragments as follows ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA were also extracted from in vitro samples of cultured GC and reverse transcription reactions were performed using the SMART PCR cDNA synthesis technology (Takara Bio.) according to the manufacturer’s procedure and as previously published 35 ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used for the purpose of inserting Capn4 into pCWX200 and pLexA were ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used were as follows ...
-
bioRxiv - Plant Biology 2023Quote: ... Two PCRs were carried out by using nested primers designed on the adaptator and on the paromomycin resistance gene using the Advantage® GC genomic LA polymerase mix (Clontech). PCR products were subcloned for sequencing and blasted on the C ...
-
bioRxiv - Genomics 2020Quote: ... The titer of each virus was determined using the Lenti-X Go-Stix Plus kit (Takara Bio), according to the manufacturer’s instruction.
-
bioRxiv - Microbiology 2019Quote: ... Whole genomic amplification of the influenza virus was conducted using Ex Taq™ Hot Start Version (TaKaRa). Forward primers were Uni-1.5 and Uni-0.5 mixed in a ratio of 3:2 ...
-
bioRxiv - Synthetic Biology 2022Quote: Pantropic vesicular stomatitis virus G pseudotyped lentivirus was produced via transfection of LentiX 293T cells (Clontech #11131D) with a pHR’SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using FuGENE HD (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... LASVpp-BlaM virus was concentrated 10 times with Lenti-X concentrator (Clontech Laboratories, Mountain View, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Cell Biology 2019Quote: Virus titer was determined by quantitative Polymerase Chain Reaction (qPCR) using Adeno-X qPCR Titration Kit (Clontech) on an Applied Biosystems 7900HT.
-
bioRxiv - Immunology 2020Quote: ... and total RNA was reverse-transcribed to cDNA with Moloney Murine Leukemia Virus Reverse Transcriptase (2641B, TAKARA). Real-time quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2020Quote: ... The purified virus was titrated with Lenti-X p24 Rapid Titer Assay (Takara Bio, Cat. No. 632200). The virus was stored at -80 °C for future use.
-
bioRxiv - Cell Biology 2021Quote: ... cDNAs were synthesized from total RNA using Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Takara, Japan) based on the manufacturer’s instructions.
-
bioRxiv - Pathology 2020Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... and virus was collected 72 and 96 hours after transfection and concentrated using Lenti-X concentrator (Clontech). Cells were then transduced with virus after growing to 75% confluency and supplemented with 10μg/mL polybrene ...
-
bioRxiv - Cell Biology 2022Quote: The AAV-sgApc virus was produced from the pAAV-Guide-it-Down construct (Clontech Laboratories Inc., 041315) using assembly primers:
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined using the Lenti-X™ p24 Rapid Titer Kit (Cat: 632200, Clontech).
-
bioRxiv - Biochemistry 2023Quote: ... The virus particles were further concentrated at 10X in volume using Lenti-X-concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: The plasmid constructs used as repair template for recombinant virus generation were generated using InFusion cloning (TaKaRa). The sequence references below are based on the HSV-1 KOS genome accession number JQ673480 (Macdonald et al 2012) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 45 cycles from 10 s at 95°C to 30 s at 60°C using a TB Green Premix Ex TaqTM GC (Takara Bio, Japan).
-
bioRxiv - Neuroscience 2021Quote: ... and 45 cycles from 10 s at 95°C to 30 s at 60°C using TB Green Premix Ex TaqTM GC (Takara Bio, Japan).
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...