Labshake search
Citations for Takara Bio :
151 - 200 of 592 citations for Oregon Green Dyes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... TB Green Premix Ex Taq 11 (TliRNaseH Plus) kit (Takara, Japan) with respective qRTPCR conditions (Annealing Tc-55°C or 60°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The enhanced green fluorescent protein (EGFP) vector was obtained from Clontech Europe ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... qRT-PCR was performed with SYBR Green master mix (DRR420A; TaKaRa) using an ABI PRISM 7500 Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative PCR was performed using TB Green Premix Ex Taq (Takara) with specific primers (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and TB Green Premix Ex Taq I (Takara Bio, Shiga, Japan) to detect messenger ribonucleic acid (mRNA) ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by TB Green Premix Ex Taq (Takara, RR420Q,), with gene-specific primer pairs (Table S1) ...
-
bioRxiv - Microbiology 2022Quote: ... qPCR reactions were performed with iQ SYBR green supermixture kit (TAKARA) in the CFX96TM Real-Time PCR System (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... and TB Green Premix Ex Taq (Tli RNaseH Plus) (Takara, RR820W) with Quantstudio6 Flex Real Time PCR system (ThermoFisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... QPCRs was detected with SYBR Green PCR Master Mix (Takara, Japan) reagent ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was performed TB Green Premix Ex Taq II (Takara) and the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... using TB green pre-mix Ex-Taq II (Cat#RR208, Takara) and KiCqStart SYBR green primers (Sigma Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by qRT-PCR with SYBR green master mix kit (Takara). The reactions were performed in triplicate using the Agilent Mx3000P qPCR system and analysis was performed essentially as described earlier (Panigrahi et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... using the TB Green Advantage qPCR premix (Takara Bio, Kutatsu, Japan) and the oligonucleotides specified in Table 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10-μL TB Green Premix Ex Taq II (Takara, Beijing, China), and 7-μL sterile deionized water ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real-time PCR using SYBR Green based method (DSS TAKARA) was employed to estimate relative transcript levels of mRNAs with GAPDH as housekeeping control gene for internal normalization ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was performed using TB Green Ex Taq II Mix (Takara) and the Thermal Cycler Dice Real-Time System (Takara).
-
bioRxiv - Cancer Biology 2024Quote: ... RT-qPCR was conducted using SYBR Green PCR Master Mix (TaKaRa) on a Fast-Real-Time PCR System ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed by using TB Green master mix (Takara-#RR820) using gene-specific primers in a 7500 Applied Biosystems Real-time PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... and used for quantitative real-time PCR amplification using SYBR Green (Takara). Target RNA expression was normalized to β2m mRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5.0 μl Fast SYBR Green Master Mix (SYBR premix EX Taq, TaKaRa). The fluorescence was measured at the end of each cycle ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
Mutant ACTB mRNA 3′UTR Promotes Hepatocellular Carcinoma Development by Regulating miR-1 and miR-29abioRxiv - Cancer Biology 2019Quote: ... Real-time PCR analyses were performed with SYBR Green (Takara, Dalian China). The results were normalized to the expression of 18S (ID ...
-
bioRxiv - Developmental Biology 2020Quote: ... QPCR was performed with TB Green Premix Ex-taq II (TAKARA BIO). Gapdh was used as internal reference to normalize the dosage of Ehz2 and Kdm6b mRNA level ...
-
bioRxiv - Molecular Biology 2021Quote: ... with TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa, RR820). The primers used in this study were as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Q-PCR was carried out with SYBR Green Premix Ex Taq (Takara) in a Light Cycler 480 II (Roche).
-
bioRxiv - Cell Biology 2021Quote: Real-time PCR was performed using TB green Premix Taq (Takara, #RR820A) on a LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara). Relative expression with respect to control (act2 gene ...
-
bioRxiv - Cancer Biology 2022Quote: ... and quantitative qPCR was conducted using SYBR Green qPCR Master Mix (TaKaRa) on the 7500 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2022Quote: ... qRT-PCR was completed via the Power SYBR Green Master Mix (TaKaRa) and an ABI 7300 real-time PCR identification apparatus (Applied Biosystem ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNA was amplified using a SYBR Green Master Mix Kit (Takara) in real-time PCR detection system.
-
bioRxiv - Neuroscience 2021Quote: ... cDNA samples were diluted and mixed with SYBR green master mix (Takara) before loading as technical triplicates for qPCR on an Applied Biosystems 7500 ...
-
bioRxiv - Microbiology 2021Quote: ... with TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara Bio). The following primer sets were used ...
-
bioRxiv - Genetics 2022Quote: ... qRT-PCR was performed by TB Green Premix Ex Taq II (TAKARA) using gene specific primers and Thermal Cycler Dice Real Time System (TAKARA) ...
-
bioRxiv - Genomics 2022Quote: ... We performed qRT–PCR with TB Green Premix Ex Taq II (Takara). Relative expression was calculated using the 2−ΔΔCt method [105] ...
-
Engineering of membrane complex sphingolipids improves osmotic tolerance of Saccharomyces cerevisiaebioRxiv - Bioengineering 2019Quote: ... qRT-PCR was performed with TB Green Premix Ex Taq (TaKaRa Bio) using an iQ5 continuous fluorescence detec0tor system (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... 200 nM SELECT primers and 2 x SYBR Green Master Mix (TaKaRa). SELECT qPCR program was perform as following condition ...
-
bioRxiv - Cancer Biology 2020Quote: ... qPCR analysis was performed using TB Green Premix Ex Taq reagent (TaKaRa) and QuantStudio5 qPCR platform ...
-
bioRxiv - Neuroscience 2020Quote: ... The qRT-PCR of genes was performed with SYBR green (Takara RR420A) reagents ...
-
bioRxiv - Genetics 2021Quote: ... qPCR was performed using TB Green Premix Ex Taq reagent (TAKARA, RR420A). GAPDH expression was determined as an internal control and fold change in expression level was calculated using the ΔΔCt method.
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR amplification was performed using SYBR Green PCR master mix (Takara) using 10ng of cDNA and 200nM of each specific primer on a 7500 Fast Real-PCR system (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2020Quote: ... The qRT-PCR of genes was performed with SYBR green (Takara RR420A) reagents ...
-
bioRxiv - Neuroscience 2020Quote: ... AGAAACGGAACTCCAGAAGACC) was performed using the SYBR Green Prime Script kit (RR420A, TAKARA). GAPDH (GAPDH F ...
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Cell Biology 2022Quote: ... The qPCR was performed using SYBR Green qPCR Master Mix (Takara, Japan). The qPCR results were analyzed by 2-ΔΔCt method ...
-
bioRxiv - Genomics 2022Quote: ... using TB Green Premix Ex Taq II (Catalog No. RR820A, Takara, Tokyo). Relative gene expression was calculated by the 2-ΔΔCt method using the housekeeping gene translation elongation factor 1-α (EF1A ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR analysis was performed using TB Green Fast qPCR Mix (Takara) and Thermal Cycler Dice Real Time System II (Takara) ...
-
bioRxiv - Plant Biology 2023Quote: ... 7.5 μl TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara). Melting curves were performed to confirm amplification specificity.
-
bioRxiv - Neuroscience 2023Quote: ... or TB Green Premix Ex Taq II (Tli RnaseH Plus) Kit (Takara), 1μM primers and 1μL of cDNA ...