Labshake search
Citations for Takara Bio :
201 - 250 of 742 citations for NT 3 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cancer Biology 2019Quote: Full-length EML4 cDNA was isolated by PCR from human cDNA (Clontech) and subcloned into a version of pcDNA3 or pcDNA3.1-hygro (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... Human universal reference total RNA (Catalog No. 636538, Clontech, Mountain View, CA) was used as a template to synthesize cDNA by reverse transcription ...
-
bioRxiv - Cell Biology 2021Quote: For expression analysis human multiple tissue cDNA panel (MTC™ Clontech, 636742) and human normal brain tissue qPCR array (OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Naïve human PSCs were cultured in the PXGL medium: Ndiff227 (Takara Bio) medium supplemented with PD0325901 (Sigma,1 μM) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... commercially available cDNAs originating from various human tissues were purchased from TaKaRa (detailed sample information is given in Table S3 ...
-
bioRxiv - Genomics 2019Quote: ... Wild-type sequences were generated by PCR using human genomic DNA (Clontech) as a template ...
-
bioRxiv - Cell Biology 2020Quote: ... Adenovirus expressing human SPARC was constructed using Adeno-X expression system (Clontech) as described before 30,31 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... pooled total RNA of human kidney and liver were purchased from Clontech. Total RNA (2 µg ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 10 ng cDNA of various tissues (Takara Human MTC panel I & II) were used for each reaction and amplified by KOD Xtreme Hot Start DNA polymerase kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA from human tissues was purchased from Clontech (catalog number 636643). Most of these samples represent pooled RNA from multiple individuals (between 2 and 63 individuals) ...
-
bioRxiv - Neuroscience 2022Quote: ... were purchased from Addgene and Genscript or amplified from human adult and fetal brain RNA (Takara) (see Table S10)(Alford et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... ERManI-YFP was constructed with human ERManI cloned into peYFP-N1 (Clontech) using Hind III and Xma I yielding ERManI fused on its C-terminus to YFP through a 6 amino acid flexible linker (SGGGGS) ...
-
bioRxiv - Cell Biology 2023Quote: Human CD34+ HSPCs were cultured overnight on RetroNectin-coated (Takara Bio USA) plates in StemSpan SFEM II medium supplemented with SCF 100 ng/mL ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA from human liver and fetal brain was purchased from Clontech Laboratories ...
-
bioRxiv - Developmental Biology 2024Quote: Human naïve cells were cultured in PXGL medium30: N2B27 medium (Takara, Y40002), supplemented with 1uM PD0325901 (Cambridge Bioscience ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Genomics 2019Quote: We used commercially available total RNA from human adipose tissue (Clontech, lot 1604416A) and blood (peripheral leukocytes ...
-
bioRxiv - Biochemistry 2020Quote: ... ADAR1 and PCBP2 cDNA were cloned from human thymus plasmid cDNA library (Clontech) using standard PCR techniques and then subcloned into indicated vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... The human ezrin sequence was cloned into a pEGFP-N1 (Clontech; 6085-1). The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene ...
-
bioRxiv - Microbiology 2021Quote: The human kidney epithelial cell line Lenti-X 293T was purchased from Takara. The human liver cell line Huh7.5.1 was provided by Dr ...
-
bioRxiv - Immunology 2020Quote: The human epithelium kidney 293T Lenti-X cells (Clontech Laboratories, Mountain View, CA) were maintained in Dulbecco’s Modified Eagles medium (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... was inducibly expressed in Lenti-x-293T human female kidney cells from Takara Bio (Catalog # ...
-
bioRxiv - Cell Biology 2020Quote: ... S5C-E was generated by fusing human Rac1 cDNA into EGFP-C1 (Clontech) and kindly provided by Dr ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c) (Clontech), and HA-tagged hamster SCAP ...
-
bioRxiv - Molecular Biology 2021Quote: ... was inducibly expressed in Lenti-x-293T human female kidney cells from Takara Bio (Catalog # ...
-
bioRxiv - Cancer Biology 2019Quote: Human NIC4 was sub-cloned into pEGFP-N3 (BD Clontech, Mountain View, CA) between EcoRI and BamHI restriction sites to obtain NIC4-GFP using the following primers:
-
bioRxiv - Cell Biology 2019Quote: ... The sequences encoding human Rap1a(Q63E) and Rap1GAP1 were cloned into p3xFlag7.1(-) (Clontech). Transient transfection was performed using TransIT-LT1 Reagent (Mirus ...
-
bioRxiv - Neuroscience 2020Quote: ... the human cytomegalovirus (hCMV) promoter/immediate-early enhancer (IE) of peGFP-N1 (Clontech) and the chimeric intron (chI ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...