Labshake search
Citations for Takara Bio :
101 - 150 of 5267 citations for Mouse Vasoactive intestinal polypeptide receptor 2 VIPR2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from mouse cochleae was extracted using an RNA Extraction Kit according to the manufacturer’s instructions (#9767, TaKaRa, Japan). The extracted RNA concentration was measured using a Nanodrop 2000 spectrophotometer (#ND-LITE ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs from the mouse forebrain were reverse transcribed using the PrimeScript II first strand cDNA Synthesis Kit (Takara Bio) with the random hexamer primer ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of RNA was used to prepare bulk TCR-seq libraries using the SMARTer Mouse TCR a/b Profiling Kit (Takara) according to instructions ...
-
bioRxiv - Immunology 2023Quote: ... A cDNA library for TCR was prepared from RNA using a SMARTer Mouse TCR a/b Profiling Kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA encoding ZP3 was restored from the mouse ovarian tissue by RT-PCR using PrimeScript RT Reagent Kit (Takara, RR037). Two PCR amplicons including the 5′ region of the TECTA-ZP and the transmembrane domain (TMD ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 (Takara, #6045) according to manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... version 2 (Takara). Fastq files were generated from bcl files using BCL2FASTQ v2.17.1.14 with default parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 (Takara Bio).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (Takara Bio).
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti dsRed (Clontech) 1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-mCherry (Takara Bio ...
-
bioRxiv - Synthetic Biology 2022Quote: ... mouse anti-TetR (Clontech; 9G9 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-dsred (Takara), rabbit anti-GFP (Proteintech) ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... and 2 ng of total RNA was amplified with SMART-Seq v4 Ultra Low Input RNA kit (Clontech; version “091817”). Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RNA quantification was performed by RT-qPCR targeting the S gene of SARS-CoV-2 using One Step PrimeScript RT-PCR Kit (Takara) with the following SARS-CoV-2 specific primers and probes ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 µg of RNA was used for the preparation of cDNA using PrimeScript Reagent Kit with gDNA eraser (Takara, Japan). Signal detection ...
-
bioRxiv - Zoology 2019Quote: ... were obtained from the mRho.V5.mER.hOr47a construct via PCR using the Advantage 2 PCR kit (Cat. Nr. 639206, Takara, Kusatsu, Japan) using the E.hOr47a_fwd and hOr47a_fwd forward primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both CnAOEC and ISO-HAS-B were cultured in Endothelial Cell Growth Medium 2 Kit (Takara Bio, Inc. Kusatsu, Japan). All cells used were routinely tested for Mycoplasma using PCR and were submitted to ICLAS Monitoring Center (Kawasaki ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated from 2 ng total RNA using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) and amplified using 11 cycles of PCR ...
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...
-
bioRxiv - Microbiology 2022Quote: ... Ct values were obtained from PCR tests conducted as administrative tests at the Toyama Institute of Health using the SARS-CoV-2 direct detection RT-qPCR test kit from Takara Bio Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... was used as a template to generate the pCMV-myc-SFPQ ΔRRM1-2 by mutagenesis using the InFusion HD kit from Clontech (catalog number 639649 ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was generated from 2 ng of RNA using the Smart-Sq V4 Ultra Low Input RNA Kit (Takara, 634894). Next ...
-
bioRxiv - Plant Biology 2023Quote: ... and cDNA was synthesized with 2 μg RNA using PrimeScript™ 1st strand cDNA synthesis kit (TaKaRa, Kusatsu, Shiga, Japan) in a final reaction volume of 20 μl following the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... Titration of the concentrated viruses was performed by AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc) following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Immunology 2020Quote: ... Tcrb amplicons were prepared using a 5’RACE-based protocol with the SMARTer Mouse TCR α/β Profiling Kit (Takara #634402) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Virus production was quantified by determining the amount of the Gag p24 protein using an enzyme-linked immunosorbent (ELISA) assay (Innogenetics or TaKaRa). For production of HIV-1 Env-pseudotyped viruses in Jurkat cells ...
-
bioRxiv - Molecular Biology 2021Quote: Secretion in PIP in NHLFs treated with MRG-201 or MRG-229 was conducted by collecting the supernatant of treated cells and performing procollagen type I PIP ELISA (Takara).
-
bioRxiv - Genomics 2020Quote: ... and the resulting DNase I-treated RNA (~2 ng) was processed for sequencing by using a SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio) according to the manufacturer’s protocol with 12 cycles of PCR followed by two rounds of clean up with 1.3X Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Genomics 2021Quote: ... were used for library construction using the SMARTer Stranded Total RNA-Seq Kit v.2 (634418, Pico Input Mammalian, Takara/Clontech, Japan) according to the manufacturer’s protocol without RNA fragmentation ...