Labshake search
Citations for Takara Bio :
251 - 300 of 5870 citations for Mouse DTW Domain Containing Protein 2 DTWD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... single cells were sorted into individual wells of 8-well PCR strips containing lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634894) with RNase inhibitor (0.17 U/μl) ...
-
bioRxiv - Neuroscience 2020Quote: ... single cells were sorted into individual wells of 8-well PCR strips containing lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634894) with RNase inhibitor (0.17 U/μl) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cloned into into modified pJet:attB:mCherry vector (Roberts et al., 2014) containing phiC31 attB site and mCherry reporter using In-Fusion HD Cloning Kit (TaKaRa/Clontech) according to the manufacture instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing RNAase inhibitor (Takara Bio, 2313B) and incubated for 15min ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing RNAse inhibitors (Takara Bio, #2313) to release mRNAs into solution ...
-
bioRxiv - Immunology 2022Quote: ... IGK and IGL 5’RACE AIRR-seq libraries were generated using the SMARTer Mouse BCR Profiling Kit (Takara Bio ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Plant Biology 2021Quote: ... A 1 μg aliquot of RNA was used for the synthesis of the cDNA first strand using a PrimeScriptTMRT reagent Kit containing gDNA eraser (TaKaRa, Shiga, Japan). The cDNA was used as the template and primers in TableS1 were used to PCR amplify the sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: The pCAG-MDM4 expression vector was established by cloning of MDM4 sequence into a pCAG vector47 containing a multiple cloning site (pCAG-MCS) using In-Fusion® Snap Assembly Starter Bundle kit (#638945; Takara Bio). A single restriction digest was performed on the pCAG-MCS vector using XhoI (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... MYC (mouse, Clontech, 631206 ...
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 100 ng/ml Doxycycline (Clontech #631311) and 0.1 μl RNAiMAX per pmol siRNA (Thermofisher Scientific #13778150 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR fragments containing pLib vector backbone (Clontech) and EF1A promoter ...
-
bioRxiv - Microbiology 2020Quote: ... Total protein was extracted from 2,000 midguts using the lysis buffer supplied in the Capturem IP & Co-IP kit (Takara, 635721). The extracted proteins were divided into two equal parts and used for immunoprecipitation (IP) ...
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs containing both His and Strep tags were purified using gravity flow columns containing His60 Ni-NTA resin (Clontech) followed by Streptactin affinity chromatography (IBA Lifesciences ...
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from mouse cochleae was extracted using an RNA Extraction Kit according to the manufacturer’s instructions (#9767, TaKaRa, Japan). The extracted RNA concentration was measured using a Nanodrop 2000 spectrophotometer (#ND-LITE ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs from the mouse forebrain were reverse transcribed using the PrimeScript II first strand cDNA Synthesis Kit (Takara Bio) with the random hexamer primer ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of RNA was used to prepare bulk TCR-seq libraries using the SMARTer Mouse TCR a/b Profiling Kit (Takara) according to instructions ...