Labshake search
Citations for Takara Bio :
101 - 150 of 872 citations for Mouse Anti Bovine Coronavirus Spike Antibody 5A4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (JL8 - Takara cat# 632381, RRID: AB_2313808), mouse anti-E-cadherin (HecD1-provided by M ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (632375, Takara Bio Inc., Otsu, Japan), mouse anti-FLAG (F3165 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse monoclonal anti-GFP (Clontech; milk; 1:2,000).
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-DSRed (targeting mCherry; 1:2000; Clontech), washed ...
-
bioRxiv - Neuroscience 2022Quote: ... membranes were incubated with mouse anti-GFP (Clontech #632380), rabbit anti-DsRed (Takara #632496) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti GFP (mouse monoclonal, JL8, Clontech; WB: 1:6000), anti-human tubulin (mouse monoclonal ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse monoclonal anti-GFP (JL8, Clontech, 632381, 1:1000) mouse monoclonal anti-vinculin (SantaCruz ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 16 μm in thickness) were processed for immunodetection of Mouse anti-GFP antibody (1:500, 632381, Takara Bio USA, Inc. Mountain View, CA) and incubated with secondary Donkey anti-Mouse Alexa Fluor 488 (1:100 ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... a commercial anti-GFP primary antibody (Clontech living colors full-length polyclonal antibody ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies anti-HA.11 (Clontech, 631207) or anti-A3H were used at a dilution at 1:500 and 1:50 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Antibodies used were: anti-dsRed (Clontech, 632496) 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP antibody (Clontech, rabbit, 1:2000), anti-Ago1 antibody (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GFP antibody (JL8) was from Clontech, and anti-Cdc37 antibody (E-4 ...
-
bioRxiv - Microbiology 2020Quote: ... The Spike ectodomain was purified by immobilised metal affinity chromatography using Talon resin (Takara Bio) charged with cobalt followed by size exclusion chromatography using HiLoad 16/60 Superdex 200 column in 150 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... The Spike ectodomain was purified by immobilized metal affinity chromatography using Talon resin (Takara Bio) charged with cobalt followed by size exclusion chromatography using HiLoad 16/60 Superdex 200 column in 150 mM NaCl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... dry milk and 0.1 % (v/v) Tween 20 and then incubated with mouse anti-6xHis tag monoclonal antibody-HRP conjugate (Clontech or Thermo Fisher Scientific, USA) in the same buffer for 2 h at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), rabbit anti-GFP (Chromotek ...
-
bioRxiv - Systems Biology 2022Quote: ... living colors mouse anti-GFP (632681, Clontech, Mountain View, CA), goat anti-GFP (ab5450 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-mCherry (1:200, Takara Bio/Clontech Laboratories, 632543), rat anti-BrdU (1:250 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), mouse anti-Dhc (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-mCherry (1:200, Takara Bio/Clontech Laboratories, 632543), rat anti-BrdU (1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... Immunoblotting was performed using mouse anti-eGFP (Takara, 1:2000), rabbit anti-Actin (Bethyl ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubation with the primary antibody (polyclonal rabbit anti-dsRed antibody, 632496, Clontech, dilution 1:500 ...
-
bioRxiv - Immunology 2019Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... The anti-GFP antibody was purchased from Clontech. The anti-CPY and anti-Pgk1 antibodies were from Molecular Probes ...
-
bioRxiv - Microbiology 2022Quote: ... Western blots using Anti-His primary antibody (Clontech) (1:4000 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-DsRed antibodies (1:3000, Takara, 632496). Sections were washed three times in PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-GFP monoclonal antibody JL-8 (632381, Clontech) was used at 1/3000 ...
-
bioRxiv - Immunology 2022Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), rabbit anti-Lcp1 (1:1000) ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... SMAD2 #3122 and SMAD3 #9523 antibodies (Cell Signalling Technology) and anti-FLAG antibody (Clontech). Horseradish peroxidase-conjugated secondary antibodies and anti-rabbit and anti-mouse antibodies were acquired from Molecular Probes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The following antibodies were used: Anti-GFP antibody (JL-8 from Takara, Shiga, Japan), anti-Flag antibody (M2 from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-P-cadherin (TAKARA Cat#M127, 1:100 for IF); mouse anti-Rac1 (Abcam Cat#ab33186 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-human GFAP (mouse IgG1, 1:2000, Takara Bio, Shiga, Japan), anti-CNPase (mouse IgG1 ...
-
bioRxiv - Microbiology 2019Quote: ... purchased antisera used were: mouse monoclonal anti-GFP (clone JL8, Clontech), rat monoclonal anti-ß tubulin (clone YL1/2 ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Neuroscience 2020Quote: ... monoclonal mouse anti-STEM121 (1:500; Y40410, Takara, Mountain View, CA), polyclonal rabbit anti-GFAP (1:500 ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-GFP clone JL-8 (Takara Bio Cat# 632380, RRID:AB_10013427), rabbit anti-FLAG clone D6W5B (Cell Signaling Technology Cat# 14793 ...
-
bioRxiv - Genetics 2021Quote: ... probed with anti-GFP (Takara Bio Clontech, #632380, mouse, 1:5000) and anti-Tubulin (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... probed with anti-GFP (Takara Bio Clontech, #632380, mouse, 1:5000) and anti-Tubulin (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... Westerns were probed with mouse monoclonal anti-GFP JL8 (#632381, Clontech) or mouse monoclonal anti-Myc 9E10 (DSHB).
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 10% Fetal Bovine Serum (Clontech). Cells were grown at 37°C with 5% CO2 and passaged using 0.05% Trypsin-EDTA solution (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).