Labshake search
Citations for Takara Bio :
151 - 200 of 2092 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... the input binary libraries (1:10 or 1:100) and the selected pools were subjected to restriction digestion using BamHI (Takara Bio Inc., Japan). The digestion products were then analyzed using a 10% polyacrylamide gel electrophoresis (PAGE ...
-
bioRxiv - Biochemistry 2020Quote: Inducible K562 cells were plated at 2.5×105 cells mL−1 in RPMI 1640 containing 0.25 μg/mL doxycycline (dox) (Takara Bio USA Inc.) in 10 cm plates and incubated at 95% humidity ...
-
bioRxiv - Plant Biology 2022Quote: ... His (SD/-Trp/-Leu/-Ade/-His) and with sprayed 100 µl of 4 mg/ml X-α-Gal (Takara Bio, CA, USA) in dimethylformamide on plates (SD/-Trp/-Leu/-His/X-α-Gal) ...
-
bioRxiv - Microbiology 2021Quote: ... plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7) and PrimeSTAR GXL Polymerase (Takara, Japan). Cycling conditions were as follows ...
-
bioRxiv - Biophysics 2021Quote: ... The 7-kb band was excised and recycled using Agarose Gel DNA Extraction Kit (TaKaRa Bio). Concurrently ...
-
bioRxiv - Cell Biology 2022Quote: MCF-7 and T47D cells were harvested and total RNA was extracted with RNA Trizol (TAKARA) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... Membrane blocking was performed with 3%BSA in PBS-t buffer for 1 h at room temperature followed by incubation with Mouse-anti-GFP (TaKaRa) (1/5,000 ...
-
bioRxiv - Immunology 2022Quote: ... Sequences encoding DCFHP (residues 1-1146 of HexaPro)2 and SΔC-Fer (residues 1-1143 as previously described)3 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Systems Biology 2021Quote: ... the inducible fluorescent protein was induced by adding 1 μg/ml doxycycline (Clontech) alone or together with 100 nM rapamycin (Harveybio ...
-
bioRxiv - Neuroscience 2021Quote: ... hLAG3 expression was induced by 1 µg/ml of Doxycycline (DOX; Clontech #631311).
-
bioRxiv - Cancer Biology 2021Quote: Tissues and cells were homogenized in 1 ml RNAisoTM Plus lysis buffer (TAKARA). Total RNA was extracted and 2 μg RNA was transcribed into cDNA with M-MLV reverse transcriptase (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... Expression of CRISPRa-SunTag system was induced using doxycycline (Clontech, 1 μg/ml) one day before differentiation and kept throughout the rest of the protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Individual punch biopsies were homogenized in 1 ml RNAiso Plus reagent (DSS Takara Bio India Pvt ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Cell Biology 2023Quote: ... crossed with WT BDF1 males at E0.5 and electroporated with RNP complex of Mavs targeting sgRNA (100 ng μL-1) and Cas9 protein (Takara Bio; 500 ng μL-1) using NEPA21 electroporator ...
-
bioRxiv - Cancer Biology 2023Quote: BON1/HA-Bcl-xL/TR-shCtBP2 and BON1/HA-Bcl-xL/TR-shRLuc #713 cells were treated with 1 µg/ml (before sorting) or 0.5 µg/ml (after sorting) doxycycline (Clontech Laboratories, Inc., 631311) for 96 hours ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... cerevisiae strain AH109 (Matchmaker 3 system, Clontech) was used ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 3’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
bioRxiv - Genomics 2023Quote: ... 100 ng to 1 µg of total RNA was used for Hi-Mammalian whole transcriptome preparation (Takara Bio) and sequencing was performed on Nextseq2000 instrument with 1 x 72 bp single-end setup ...
-
RNA-binding protein YBX1 promotes Type H vessels dependent bone formation in an m5C-dependent mannerbioRxiv - Molecular Biology 2023Quote: ... The paraffin sections were de-waxed and stained with primary antibody OCN (#M173, Takara Bio, Japan, 1:100), and counterstained with Harris Hematoxylin.
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... DAPI stained nuclei were diluted to a concentration of 60,000 cell/mL in 1x PBS + 1% BSA + 1x Second Diluent + 0.2U SUPERase·In RNase Inhibitor and dispensed onto the ICELL8 3 ‘DE Chip (Takara Bio, Cat# 640143) using the ICELL8 MultiSample NanoDispenser ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Immunology 2021Quote: ... A2058 and MDST8 as previously described (7) with small changes for adherent cell lines omitting RetroNectin (Clontech). LCL-1 was transduced with single minigenes ...
-
bioRxiv - Neuroscience 2023Quote: Neurons were transfected at day in vitro (DIV) 7 using CalPhos Mammalian Transfection Kit (Takara Bio, 631312). Transfection solution was prepared by adding 1.5 µg DNA per construct (3 µg in total ...
-
bioRxiv - Developmental Biology 2024Quote: ... For beta-catenin overexpression the CHIR99021 was substituted with 1 µg/ml doxycycline (Clontech).
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...