Labshake search
Citations for Takara Bio :
101 - 150 of 1315 citations for Mono 2 Ethyl 5 Carboxypentyl Phthalate 90% Pure 13C4 99% Dehp Metabolite V ;100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... The solubilized protein was incubated with 2 mL TALON cobalt metal-affinity resin (Takara Bio) for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... GP2-293 cells were cultured in DMEM (FUJIFILM Wako Pure Chemical) supplemented with 10% tetracycline-free FBS (Takara Bio).
-
bioRxiv - Neuroscience 2024Quote: ... After the addition of 5 µl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) to the cap ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were seeded at 25-30% confluency onto the prepared coverslips placed in 6-well plates in cell imaging media comprising phenol-red free DMEM (HyClone) supplemented with 10% (v/v) FBS (ClonTech) and 1 mM sodium pyruvate and allowed to settle for at least 4h ...
-
bioRxiv - Systems Biology 2020Quote: ... The cell lines were cultured in IMDM medium (Quality Biological) supplemented with 10% (v/v) Tet System Approved fetal calf serum (Takara Bio/previously Clontech), 100 U/mL penicillin ...
-
bioRxiv - Microbiology 2019Quote: ... We added 5 μl of transformants (107/mL) on SD/–Leu/–Trp (Clontech, Mountain View, CA, USA) and SD/–Ade/– His/–Leu/–Trp (3 mM 3-AT ...
-
bioRxiv - Bioengineering 2020Quote: The cleared lysate was poured on 5 mL packed Ni-NTA agarose (His60 Superflow, TaKaRa Bio Europe) gravity flow columns ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the supernatant was loaded onto a 5 ml column with prewashed Talon resin (Clontech Laboratories, Inc, CA). The column was washed three times with the low pH buffer (pH 6.3) ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA from each candidate cell line was digested to single nucleoside using nuclease P1 (Fujifilm Wako Pure Chemical Corporation) and bacterial alkaline phosphatase (TaKaRa), followed by mass spectrometry analysis ...
-
bioRxiv - Genetics 2023Quote: Total RNA extracted from freshly harvested spikes at single ridge end-stage with the RNAprep pure Plant Kit (Biofit Biotechnologies co. Ltd, Chengdu, China) was digested with RNase-free DNase (Takara) to remove residual genomic DNA ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Immunology 2022Quote: ... The NTD domain was purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant protein were purified to >90% electrophoretic purity by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with imidazole as described previously24 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 × 104 SH-SY5Y cells in 90 µL of growth media containing no antibiotics were plated in opaque TC-treated 96-well plates containing Xfect (Clontech)/DNA transfection complexes ...
-
bioRxiv - Immunology 2023Quote: ... cells were harvested and resuspended in retroviral supernatant and centrifuged for 90 minutes at 1000g at 32°C on retronectin (TaKaRa) coated plates.
-
bioRxiv - Cell Biology 2024Quote: ... in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90%) Lenti-X 293T cells (Clontech) grown on a 10-cm tissue culture dish ...
-
bioRxiv - Plant Biology 2022Quote: ... purified with Fast pure gel DNA extraction mini kit (DC301, Nanjing Vazyme Biotech, China) and then cloned into the pMD19-T vector (TaKaRa, Japan). The CRISPR-edited sequences were screened by Sanger sequencing of pMD19-T vector.(K ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Systems Biology 2020Quote: ... The cell lines were cultured in IMDM medium (Quality Biological) supplemented with 10% (v/v) Tet System Approved fetal calf serum (Takara Bio/previously Clontech), 100 U/mL penicillin ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...
-
bioRxiv - Immunology 2021Quote: ... The supernatants were collected and applied to a column filled with 5 ml of TALON Metal Affinity resin (Takara) previously equilibrated with ice-cold PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... cultures were split into two 2-ml cultures of which one was supplemented with 250 nM rapalog (Clontech). Mislocalisation of the target protein was verified by live-cell microscopy.
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Synthetic Biology 2020Quote: ... dry milk and 0.1 % (v/v) Tween 20 and then incubated with mouse anti-6xHis tag monoclonal antibody-HRP conjugate (Clontech or Thermo Fisher Scientific, USA) in the same buffer for 2 h at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: Using the Cogent NGS Analysis Pipeline software v 1.5.1 (Takara), FASTQ files containing all indices for each chip were demultiplexed to FASTQ files containing one index per file ...
-
bioRxiv - Biochemistry 2022Quote: ... The precipitated material was removed by centrifugation and the soluble fraction was loaded onto a column (5 mL) containing Talon affinity resin (Clontech) equilibrated in buffer A ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...
-
bioRxiv - Microbiology 2023Quote: ... The protein-bead mixtures were then loaded onto a gravity column (TALON 2 mL Disposable Gravity Column, Takara #635606). Lysate was loaded into the column 5 times with gravity flow and then washed in a 1M NaCl buffer 3 times ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-TEV tagged protein was captured with Co-TALON resin (Clonetech, Takara Bio USA, 2 mL slurry/liter culture) at 4 ºC for 1 h with constant end-to-end mixing ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products of the expected size were purified using the Easy Pure Quick Gel Extraction Kit (Transgen Biotech, Beijing, China) and cloned into TA Vector (Takara Biotechnology, Dalian, China). Positive clones were selected and sequenced by Beijing Genomics Institute (Beijing ...
-
bioRxiv - Physiology 2022Quote: ... and 10 mM 2,3-butanedione monoxime (BDM; FUJIFILM Wako Pure Chemical Corp.) in Ca2+- and Mg2+-free phosphate-buffered saline (PBS; Takara Bio Inc., Kusatsu, Japan). The aortic valve was then ligated ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were prewarmed at 37°C for 5 min and digested samples were treated with 66.6 U/mL (final conc.) MNase enzyme (Takara Bio, #2910A) at 37°C for 30 min ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Template DNA was extracted from antenna or leg of the individuals by placing them in 50 μL of 5% Chelex solution (Chelex 100, 100–200 mesh, Bio Rad) and 0.5 μL of proteinase K (20mg/mL, Takara Bio Inc.), then incubating for 24 h at 56 °C and 5 min at 95 °C ...
-
bioRxiv - Genomics 2020Quote: ... the nucleus pellet was washed with 5 mL Nuclei Suspension Buffer (NSB; consisting of 1x PBS, 0.01% BSA and 0.1% RNAse inhibitor (Clontech, Catalog no.2313A)) ...
-
bioRxiv - Cell Biology 2021Quote: ... supernatant was removed and the nucleus pellet was washed with 5 ml nuclei suspension buffer (NSB; consisting of 1X PBS, 0.01% BSA and 0.1% RNase inhibitor (Clontech, cat. no. 2313A)) ...