Labshake search
Citations for Takara Bio :
451 - 500 of 877 citations for Lysophosphatidic Acid Receptor 5 LPAR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Cell Biology 2019Quote: Chimeras 1-5 were first generated in pBluescript by In-Fusion cloning (Takara Bio, USA, Mountain View, CA) of inserts encoding different fragments of human Myo1e PCR-amplified from pEGFP-C1-myo1e-EcoR1-into the PCR-amplified segments of pBS-SpMyo1 vector using primers designed to replace selected SpMyo1 domain sequences with corresponding HsMyo1e sequences ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from seedlings and ligated to the 5’ RNA adaptor by T4 RNA ligase (TaKaRa). Reverse transcription was performed with 9-nt random primers and the cDNA amplified by PCR with an adaptor primer and a gene-specific primer ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Cancer Biology 2020Quote: ... three replicate wells of 5□×□104 cells per well were seeded in a retronectin (Takara Bio Inc, JPY) coated 24-well XF24 plate ...
-
bioRxiv - Immunology 2022Quote: ... IGK and IGL 5’RACE AIRR-seq libraries were generated using the SMARTer Mouse BCR Profiling Kit (Takara Bio ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was supplemented with 5 mM imidazole pH 8.0 before incubation with Co2+ charged TALON resin (Clontech) for 1 h on a rotator (1 ml resin slurry per L original culture volume) ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
A bacterial derived plant- mimicking cytokinin hormone regulates social behaviour in a rice pathogenbioRxiv - Microbiology 2021Quote: ... 5 μg of total RNA was reverse transcribed into cDNA using EcoDryTM Premix (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions using random hexamer primers ...
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Genomics 2022Quote: ... in which 5 pmol of substrate primer and 12,5 µl of TB Green Premix Ex Taq II (Takara) were added ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cancer Biology 2022Quote: CPT1a knockdown cell lines were generated using the shRNA-expressing lentiviral pLKO-shRNA2 vector (No. PT4052-5; Clontech), with a puromycin selection cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... T cells were mixed with lentivirus at multiplicity of infection (MOI) equal to 5 in Retronectin (Takara, T100B)-coated culture plates and centrifuged at 1800 g for 1 h at 32 °C for lentiviral transduction before returning to normal culture condition ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... YFP-CESA6 protein was detected using anti-GFP antibody (Takara, catalog # 632381) and SEC12 was detected using anti-SEC12 antibody (Bar-Peled and Raikhel ...
-
bioRxiv - Neuroscience 2021Quote: ... Monoclonal GFP antibodies (clone JL-8; lot# A5033481-A) were from Clontech Takara Bio (San Jose ...
-
bioRxiv - Neuroscience 2021Quote: ... the primary antibody rabbit anti-dsRed (Takara Bio, Cat# 632496, 1:500) and the secondary antibody goat anti-rabbit ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2020Quote: ... then transferred to drop of GFP polyclonal antibody (TaKaRa, Cat. No. 632592) at 1:50 for 1 h and subsequently in second antibody conjugated with 18-nm gold particles (Jackson ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DSRed antibody (Living Colours; Clontech; Cat# 632496, dilution 1:300), rabbit anti-red fluorescent protein (RFP ...
-
bioRxiv - Plant Biology 2022Quote: ... Blots were probed with anti-GFP monoclonal antibody JL-8 (632381, Clontech) diluted at 1/3000 in 1X PBS containing 0.1% Tween-20 and 5% non-fat milk ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were normalized to biosensor expression using an anti-GFP antibody (Clontech).
-
bioRxiv - Neuroscience 2019Quote: ... Slides were then incubated with rabbit anti-DsRed primary antibodies (632496, Clontech) and donkey anti-rabbit AlexaFluor 594 secondary antibodies (711-585-152 ...
-
bioRxiv - Neuroscience 2022Quote: ... VTA slices were incubated with rabbit anti-dsRed polyclonal antibody (632496, Takara) as the primary antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: DS Red (1:1000, Rabbit, Takara-Clontech), ChAT (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following antibodies were used: rabbit DsRed (1:3000, Takara Bio, 632496), rabbit β3-tubulin (1:3000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a dilution 1:000 of the anti-DsRed antibody (Takara; 632496) for mCherry were used ...
-
bioRxiv - Microbiology 2023Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... IHC was conducted using rabbit primary antibody dsRed (1:500, #632496, Takara) to label TdT+ cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Sections were incubated overnight with mouse anti-STEM121 primary antibody (Takara, Y40410) and then developed with a DAB substrate kit (Cell Signaling ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated in primary antibody (Rabbit-DsRed, 1:1000 dilution, Takara) overnight at 4 ° C ...
-
bioRxiv - Molecular Biology 2024Quote: ... as well as the rabbit primary antibodies α-DsRed (Clontech, 632-496), α-CIRBP (Proteintech ...
-
bioRxiv - Cell Biology 2024Quote: ... Western blotting was performed using antibodies against GFP (clone JL8, 63268; Clontech), Y15-phosphorylated Cdk1 (anti-Phospho-cdc2 ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mCherry were isolated by PCR from various templates and inserted into the pGL4.23-(C120×5)-TATA vector with In-Fusion cloning (Clontech) according to manufacturer instructions using a 1:2 vector-to-insert ratio to generate optogenetic response plasmids ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction mixture (10 μl total volume) included 5 μl SYBR Premix Ex Taq II (TaKaRa, Dalian, China), 3.5 μl ddH2O ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Microbiology 2022Quote: ... The 5’ end regions of MIC14 and MIC15 were amplified using the SMART RACE cDNA Amplification Kit (Clontech BD) using total or poly(A)+tachyzoite RNA (strain RH ...
-
bioRxiv - Molecular Biology 2022Quote: ... bound RNAs were eluted via 30min incubation at 55°C in wash buffer supplemented with 0.5 μg/μL Proteinase K and 0.1% SDS and isolated using Qiazol/chloroform separation and NucleoSpin RNA columns (Takara). Luciferase control RNA is spiked in to each sample (5ng/sample ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Cell Biology 2019Quote: pLL6-MYH12A construct was made by replacing 5’LTR promoter in pLL5.0 (Cai et al., 2008) with PTight promoter from pTRE-Tight Vector (Clontech) and inserting human MYH12A using EcoRI-BamHI cloning sites ...