Labshake search
Citations for Takara Bio :
51 - 78 of 78 citations for L Cysteinesulfinic acid monohydrate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Immunology 2023Quote: ... The expression vectors for the S variants with multiple amino acid changes or deletions were generated using the In-Fusion HD cloning kit (Takara Bio). The pcDNA3.1-hACE2 used to express human ACE2 (hACE2 ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were maintained at 37 °C in a humidified atmosphere at 5% CO2 in DMEM 4.5g/L Glucose with UltraGlutamine media supplemented with 10% of Tet-free FBS (Clontech) and 1% penicillin/streptomycin.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biophysics 2019Quote: ... D40A mutation and deletion of C-terminal 10 amino acids were introduced into pET15-sfGFP-minD by using the PrimeSTAR Max mutagenesis protocol (TaKaRa, Shiga, Japan). Similarly ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Cell Biology 2019Quote: ... First-strand cDNA was synthesized from l μg of RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (catalogue No. RR047A, TaKaRa). qPCR was performed in triplicate in 20-μl reactions containing SYBR Premix Ex Taq II (catalogue No ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of each common amplicon were pooled and gel purified from a 1.5% agarose gel (Nucleospin clean-up, Takara Bio), eluting in 35 μl 10 mM Tris-HCl ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Biophysics 2019Quote: ... The pCD86-EGFP had been created by inserting CD86 with a 21 amino acid linker coding region on its C-terminus immediately before EGFP in pEGFP-N1 (Clontech/Takara, Mountain View, CA). The CD86-21aa was amplified from pCD86-mEos2 (Mike Heilemann via Addgene ...
-
bioRxiv - Cell Biology 2019Quote: Amino acid substitutions in RNF167 were made using site-directed mutagenesis by Prime Star GXL-DNA polymerase (R050A, Takara Bio Inc., Otsu, Japan) according to the manufacturer’s protocol with the following primers:
-
bioRxiv - Genetics 2019Quote: ... About 1 μL of viral RNAs were used as template to synthesize cDNAs with PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Absolute quantitative real-time PCR assay was performed with SYBR green I (TOYOBO ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa (cTT20.1166, gift from Kara L. McKinley and Iain Cheeseman) and Lenti-X HEK293T cells (Takara Bio, used for lentivirus production) were cultured in DMEM (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... were sub-cloned from pCMV-HA-BTN3A2-L and pCMV-HA-BTN3A2-S expression vectors into the pLVX-tight-puro vector (632162, Clontech, USA) (Supplementary Table S1) ...
-
bioRxiv - Plant Biology 2023Quote: ... were used to co-transform yeast strain AH109 and colonies carrying both vectors were selected on SD medium without tryptophan (-W) and leucine (-L) (TaKaRa 630317) at 28°C ...
-
bioRxiv - Biophysics 2019Quote: ... The pCD86-EGFP had been created by inserting CD86 with a 21 amino acid linker coding region on its C-terminus immediately before EGFP in pEGFP-N1 (Clontech/Takara, Mountain View, CA). The CD86-21aa was amplified from pCD86-mEos2 (Mike Heilemann via Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Biochemistry 2022Quote: ... S domains and variants were purified similar to S protein using nickel resin (10 mL/L, His60 Ni2+ superflow resin, Takara cat# 635664) with wash buffer (25 mM MES ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.5 µl used as a source of genomic DNA in 20 µl PCR reactions with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... and used to generate Illumina-ready heavy and light chain sequencing libraries using the SMARTer Mouse BCR IgG H/K/L Profiling Kit (Takara, Cat# 634422). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... pDUP50M1 or pDUP51-ΔM and pDUP50-ΔM (a kind gift from D. L. Black, UCLA, USA) and pCMS-EGFP (Takara Bio USA, Inc) or pEGFP-IQGAP1 (Ren et al. ...