Labshake search
Citations for Takara Bio :
251 - 300 of 394 citations for L Aspartic Acid N T Boc B Bz Ester 13C4 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... For Yeast-Two-Hybrid assays HvRIPb and HvRIPb truncations were subcloned from the pGEM-T easy vector into pGADT7 and pGBKT7 plasmids (Clontech Laboratories) using the EcoRI and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: A HeLa-T-PFK1-mEGFP stable cell line (hereafter, HeLa-T-PFK1G) was generated using the HeLa Tet-On® 3G inducible expression system (Clontech) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara, Japan), and verified by sequencing ...
-
bioRxiv - Epidemiology 2019Quote: ... The PCR products of the three fragments were cloned into a pMD18-T easy vector (TaKaRa Biotechnology Co., Ltd., Dalian, China) for later sequencing (Syn-Biotechnology ...
-
bioRxiv - Plant Biology 2019Quote: ... The yeast containing Gal4 DNA-BD fused with lamin (pGBKT7-Lam) and the pGADT7-T from the Matchmaker Gold Yeast Two-Hybrid System kit (Takara Bio) were used as a negative control.
-
bioRxiv - Plant Biology 2020Quote: ... plant intron Syn7 [34] regulated by a double-enhancer Cauliflower mosaic virus 35S RNA promoter (P35S2) and a nos terminator in the T-DNA binary vector pBI121 (Clontech, Switzerland). Syn7 was amplified with the primers 5′- GAGCTGAAAGggtaagattatcgatatttaaattatttatttcttcttttc-3′ and 5′-TGAAGTCGATGCctgcatgatatcataaaaccatgga-3′ specifying the splicing junctions and then inserted into the YFP coding region by overlapping PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... The targeted gene and its flanking sequences were amplified by PCR with Synechocystis chromosome DNA as the template and cloned into pMD18–T vector (Catalog No: D101A, Takara, Japan). The physical map of the Synechocystis genome region containing sll0445–sll0447 or sll1334 ...
-
bioRxiv - Molecular Biology 2021Quote: Gene-specific target sequences as well as a heterologous fragment from Mus musculus (Muslta) used for double-stranded RNA (dsRNA) synthesis were amplified and cloned into pMD™ 19-T Vector (Takara). Templates used for single-stranded RNA were amplified with primers that incorporated with the T7 promoter sequence (S4 Table) ...
-
bioRxiv - Microbiology 2021Quote: ... were transduced into TCR-deficient Jurkat cells or primary T-cells using the Plate-GP and PG13 cell-based retrovirus system and Retronectin (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... activated CD8+ T cells were transduced with MSCV-ASNS-OE or MSCV-EV viral particles on RetroNectin-coated plates (Takara Bio). 24 hours later ...
-
bioRxiv - Plant Biology 2022Quote: ... purified with Fast pure gel DNA extraction mini kit (DC301, Nanjing Vazyme Biotech, China) and then cloned into the pMD19-T vector (TaKaRa, Japan). The CRISPR-edited sequences were screened by Sanger sequencing of pMD19-T vector.(K ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR products were amplified with specific primers based on the off-target sites and purified products were cloned into pMD19-T vector (TaKaRa, Japan) for Sanger sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... The copy number was calculated using the standard curves for cloned Tert and Dloop in a pMD19-T Easy vector (TaKaRa, 3271), respectively ...
-
bioRxiv - Neuroscience 2023Quote: Artificially synthesized (G4C2)50 sequences flanked at the 5′ end with an EagI recognition site and at the 3′ end with a PspOMI recognition site were subcloned into T-vector pMD20 (Takara Bio). To generate a longer repeat size ...
-
bioRxiv - Bioengineering 2024Quote: AAV-vector plasmid and AAV-crTSG were used for AAV9 production and purification using Lenti-X 293 T cells (Takara Bio). Each set of Lenti-X 293 T cells (6 150mm-plates ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μL of treated RNA was reverse transcribed using oligo d(T) primers (PrimeScript RT Reagent Kit, Takara Bio, Kyoto Japan). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Pathology 2019Quote: ... and 1-1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, Mountain View, CA). For cleavage site validation experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... the sequence of NAGTI-GFP (N-acetylglucosaminyltransferase I fused to GFP; (Shima et al., 1997)) was cloned into pLVX-TetOne-Puro (Clontech). The constructed plasmid was then co-transfected with psPAX and pVSVG into HEK293T cells to produce lenti-viruses ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x) ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2021Quote: ... an additional set of genes encoding pTF.CREG1 with N-terminal truncations (Δ26, Δ31, Δ39, Δ43) was generated by PCR using PrimeStar GXL DNA Polymerase (Takara Bio), primer sets JT33/JT32 ...
-
bioRxiv - Biophysics 2021Quote: ... AY457063.1) and PIKfyve-KYA hyperactive mutant (E1620>K, N1630>Y, S2068>A) were cloned into PCMV-HA-N vector (Clontech) and gifted by Lois Weisman lab ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... A plasmid expressing mouse GR tagged in the N-terminus with mCherry was developed by amplifying mouse GR coding sequence and in-frame cloning in pmCherry-C3 (Clontech). Point mutations and deletions were introduced using the Quickchange XL mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Cancer Biology 2024Quote: ... were subcloned and fused with the CD8 signal peptide sequence (MALPVTALLLPLALLLHAA) followed by a Myc-tag at the N-terminus in pIRESpuro3 (Clontech). Humanized EREG mAbs H231 and H206 (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Physiology 2019Quote: Cells were plated onto poly-L-lysine-coated coverslips and transfected using the Xfect (Clontech) transfection reagent ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.