Labshake search
Citations for Takara Bio :
451 - 500 of 922 citations for Kallikrein 3 PSA Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Cell Biology 2020Quote: The commercially available Cellartis Human iPS Cell Line 12 (Takara Bio Inc., Kusatsu, Japan) was used as the human iPS Cell line ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA from the human brain (#636530) and testis (#636533) was purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... was generated by PCR amplification of human S1R gene (www.ncbi.nlm.nih.gov/nuccore/NM_005866.3) and cloning into pEGFP-N2 vector (Clontech) using HindIII/XbaI cloning sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Transplanted hiOLs were identified using anti-human cytoplasm (STEM121; Takara, Y40410, IgG1, 1:100), anti-human nuclei (STEM101 ...
-
bioRxiv - Cell Biology 2021Quote: ... The human fimbrin sequence was cloned into a pEGFP-C1 plasmid (Clontech; 6084-1). The human ezrin sequence was cloned into a pEGFP-N1 (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... The HB-EGF cDNA was obtained from the Human Brain Matchmaker cDNA library (Clontech). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... HEC1 and BUBR1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B55α was PCR amplified from HUVEC cDNA and cloned into pEGFP-C1 (Clontech) using HindIII and BamHI sites ...
-
bioRxiv - Biophysics 2022Quote: ... and human CaMKIIK42RD135N with a C-terminal AviTag were cloned into pEGFP-N1 (Clontech) vector ...
-
bioRxiv - Biophysics 2022Quote: The coding sequence of human PAC (NP_060722) previously subcloned into pIRES2-EGFP vector (Clontech) using XhoI and EcoRI restriction enzyme sites9 was used for whole-cell patch clamp recording ...
-
bioRxiv - Immunology 2023Quote: Immunocult-stimulated human CD3+ T cells were retrovirally transduced on Retronectin-coated plates (TaKaRa). 500 µL of cells per well at 0.5 × 106 cells/mL were supplemented with 0.5 mL retroviral supernatant and centrifuged for 90 minutes at 900 g at 32°C ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP-tagged human tauKQ and tauP301L were expressed from the pEGFP-C1 plasmid (Clontech). Expression of mApple or GFP in cultured neurons was done using pGW1 mApple and pEGFP-C1 plasmids ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Cancer Biology 2023Quote: Human DHRS7 was expressed as a GFP fusion using the pEGFP-N2 vector (Clontech) generated previously [5] ...
-
bioRxiv - Synthetic Biology 2023Quote: Human Embryonic Kidney (HEK) 293 cells (ATCC, CRL-1573) and HEK293T-LentiX (Takara Biosciences) were cultured in standard culture conditions (37ºC and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human CXCR4 was cloned into the pAcGFPm-N1 plasmid (Clontech Laboratories, Palo Alto, CA), as described (20).
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney cells (Lenti-X 293T Cell line from Takara. Cat no. 632180) were grown in DMEM/F12 media (GIBCO ...
-
bioRxiv - Molecular Biology 2024Quote: The human embryonic kidney (HEK) 293T cell line was purchased from Takara (Cat# 632180) and cultured in a humidified 95% air / 5% CO2 incubator at 37°C in a standard Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Duke University Medical Center) and HeLa Tet-Off (HTO; human, female, cervix; Clontech, RRID: CVCL_V352) cells were cultured in high-glucose ...
-
bioRxiv - Neuroscience 2021Quote: ... The WT hPNPO cDNA was amplified from the human brain cDNA library (TaKaRa, Cat #637242) [24] ...
-
bioRxiv - Developmental Biology 2021Quote: ... cryosectioned brains were stained to detect expression of human cytoplasmic marker STEM121 (TaKaRa, cat. Y40410) and human-specific GFAP marker STEM123 (TaKaRa ...
-
bioRxiv - Biochemistry 2020Quote: Human embryonic kidney 293T cells (‘293T’) and Lenti-X 293T cells were purchased from Clontech/Takara Bio (Mountain View ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Cell Biology 2020Quote: ... CHO-K1 cells were transfected with ACP-human IR plasmid using Xfect transfection reagent (Takara). 1 day after transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... Shortly, hiPSC lines (C1, C2, C3) and the commercial human iPSC-line Chipsc4 (Takara, Sweden) were cultured and differentiated into cortical NSCs as described elsewhere (23) ...
-
bioRxiv - Cell Biology 2022Quote: Full length wild type human RORβ (NM_006914.3) was subcloned into the pLPCX retroviral vector (Clontech) using XhoI and NotI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2019Quote: PtK2 GFP-α-tubulin cells (stable line expressing human α-tubulin in pEGFP-C1; Takara Bio Inc. ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA encoding human full-length MuSK was cloned into pIRES2-EGFP plasmid vector (Clontech). AChR and MuSK vectors were kindly provided by Drs ...
-
bioRxiv - Neuroscience 2022Quote: 50 µg of human cerebral cortex lysate (Protein Medley, Takara, Kusatsu, Japan, Cat. No. 635323) were diluted and prepared according to manufacturer’s instructions (protocol PT1602-1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The bait stain was combined with a Mate & Plate™ Human Heart library (Takara Bio) for 24 hours after which cells were plated on selective synthetic defined (SD ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Aurora A and TPX2 were amplified from human testis cDNA (Marathon cDNA, Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... and SOX4 were amplified from a reverse transcript of Human Fetal Brain Total RNA (Takara) by high-fidelity PCR using Phusion DNA Polymerases (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... The ORF of human KIF23 was cloned within pCAX vector using In-Fusion system (TaKaRa). The disease associated c.755T>A mutation was introduced to human KIF23 cDNA by the PCR-based mutagenesis as described (Xia et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...