Labshake search
Citations for Takara Bio :
201 - 250 of 953 citations for Integrin beta 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Genomics 2021Quote: ... tissue or cells were placed in 2mL of EZ lysis buffer containing Recombinant RNase Inhibitor (Takara Bio 2313A), dounced 24 times with pestle A ...
-
bioRxiv - Genomics 2020Quote: Lysis plates were prepared by dispensing 0.3μL lysis buffer (4 U Recombinant RNase Inhibitor (RRI) (Takara Bio, 2313B), 0.12% Triton™ X-100 (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA was extracted using the hot phenol method and treated with recombinant DNase I (Takara, cat# 2270A) in the presence of RNasin Plus (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... for 15 min at 37°C in the presence of 80 U of recombinant RNase inhibitor (Takara Bio). Next ...
-
bioRxiv - Immunology 2023Quote: ... 0.6% NP-40 and freshly added 1mM DTT) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B) and incubated for 5 minutes on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... by dispensing individual cells in 5 nL drops directly into 3 µL ice-cold single cell lysis buffer (scLB, 0.134% Triton X-100 [Sigma], 0.5 U/µL recombinant RNase inhibitor [Takara, 2313B] ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Cell Biology 2024Quote: ... the annealed LifeAct (forward: 5’-TCGAGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAGGG-3’; reverse: 5’-GATCCCTTCTTCCTTTGAGATGCTTTCGAATTTCTTGATCAAATCTGCGACACCCATC-3’) was fused to N-terminal of EGFP-N1 vectors (Clontech). To generate pLifeAct-mCherry-N1 vector ...
-
bioRxiv - Genetics 2020Quote: Gal4-based Matchmaker Two-Hybrid System 3 (Clontech) was used according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using MightyAmp™ DNA Polymerase Ver.3 (TaKaRa) and ND5 universal primers (Table S3) ...
-
bioRxiv - Microbiology 2022Quote: ... The two-hybrid system Matchmaker 3 from Clontech was used as per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: The Matchmaker Yeast Two-Hybrid System 3 (Clontech) was used for yeast two-hybrid assays to examine the p3 interaction with NbP3IP ...
-
bioRxiv - Cell Biology 2023Quote: Gal4-based Matchmaker Two-Hybrid System 3 (Clontech) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-dsRed (Takara Bio) 1:500 or chicken anti-GFP (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-dsRed rabbit polyclonal (Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit-anti-GFP (polyclonal, Takara) 1:5000 for denatured blots ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (Takara #632496), mouse anti-Actin (Sigma #A4700 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-DsRed (632496, Clontech). EdU+ cells were detected using the Click-iT EdU Imaging kit (Molecular Probes ...
-
bioRxiv - Neuroscience 2021Quote: ... mCherry (rabbit-anti-dsRed; Takara Bio ...
-
Mask, the Drosophila Ankyrin Repeat and KH domain-containing protein, regulates microtubule dynamicsbioRxiv - Neuroscience 2021Quote: ... rabbit anti-mCherry (632496, Clontech) at 1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-DsRed (Takara, 632496), and mouse anti-Tnnt (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-dsRed (Takara Bio) 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-dsRed (Clontech, 632496) at 1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... FOXG1 (rabbit, 1:200, Takara), FOXP2 (goat ...
-
bioRxiv - Neuroscience 2023Quote: Rabbit anti-Dsred (Takara 632496)
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed (632496, Clontech), rabbit anti-Lcp1 (Jin et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit anti-Dsred (Takara, 632496), rabbit anti-VAChT (SYSY ...
-
bioRxiv - Neuroscience 2020Quote: ... each well of the lysis plates contained 0.4 μL lysis buffer [0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... lysed by sonication and the recombinant His-tagged protein purified from cell-free extracts using IMAC (Talon resin, Clontech) as previously described19.
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...