Labshake search
Citations for Takara Bio :
1 - 50 of 369 citations for Integrin Alpha L ITGAL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1999) with a retroviral vector expressing integrin β1 under a tet-inducible promotor (Retro-X™ Tet-On®; Clontech, USA). Integrin β1-induced and FACS sorted cells were cultured in DMEM with 10% fetal bovine serum ...
-
bioRxiv - Microbiology 2022Quote: ... X-alpha-Gal (X-α-gal) and aureobasidin A (AbA) were obtained from TaKaRa. Plasmids ...
-
bioRxiv - Neuroscience 2019Quote: ... and doxycycline 2g/L (Clontech). On day 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Doxycycline (2 mg/L, Clontech) was also included on d0 to induce TetO gene expression by binding to rtTA and the TetO promoter upstream of the Ngn2 gene ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Plant Biology 2024Quote: ... 0,77g/L SD-URA drop out mix (Clontech), 0.67 g/L Yeast Nitrogen Base (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2023Quote: ... pTIT-P and pTIT-L using Xfect Transfection Reagent (Takara, 631318) according to the instructions of the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... The clones growing in the –L/-T liquid selection medium (Clontech) were diluted by a 10x series dilution and spotted onto –L/-T/-H medium (Clontech ...
-
bioRxiv - Plant Biology 2024Quote: ... and 10 μ L SYBR premium ExTaq Perfect Real Time (TaKaRa Bio), adjusted to a final volume of 20 μL with water ...
-
bioRxiv - Cancer Biology 2023Quote: ... Clarified lysate was mixed with ∼0.5 ml/L of culture cobalt resin (TaKaRa) for one hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... The primary antibody rabbit anti-human Cas9 Polyclonal Antibody (Clontech) was diluted 1 ...
-
bioRxiv - Microbiology 2022Quote: ... monoclonal antibody (Clontech) and peroxidase-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Physiology 2019Quote: Cells were plated onto poly-L-lysine-coated coverslips and transfected using the Xfect (Clontech) transfection reagent ...
-
bioRxiv - Plant Biology 2024Quote: ... were diluted by a 10x series dilution and spotted onto –L/-T/-H medium (Clontech) to determine interactions between the two proteins.
-
bioRxiv - Genetics 2021Quote: ... and were routinely cultured on gelatin-coated plates in t2i/L media: NDiff (N2B27) (Takara #y40002) supplemented with titrated 2i (0.2μM PD0325901 ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Molecular Biology 2022Quote: ... EBIV M/L segment-specific sequences were amplified by PCR including Universal Primer A Mix (Takara), Gene-Specific Primers (GSPs ...
-
bioRxiv - Microbiology 2024Quote: ... and L gene open reading frames (ORF) were amplified with PrimeSTAR® Max DNA Polymerase (TAKARA) and ligated between the NcoI and BamHI sites of the pTM1 vector with In-Fusion® Snap Assembly Master Mix (TAKARA ...
-
bioRxiv - Microbiology 2023Quote: ... anti-GAPDH antibody (Clontech) at a 1/2500 dilution ...
-
bioRxiv - Genetics 2019Quote: ... Antibodies used were GAL4 AD Mouse Monoclonal Antibody (Takara Bio USA, Inc. #630402), GAL4 DNA-BD Mouse Monoclonal Antibody (Takara Bio USA ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubation with the primary antibody (polyclonal rabbit anti-dsRed antibody, 632496, Clontech, dilution 1:500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... gDNA from all cells were isolated using the Machery Nagel L Midi NucleoSpin Blood Kit (Clontech, 740954.20). Modifications to the manufacturer’s instructions were added as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... SMAD2 #3122 and SMAD3 #9523 antibodies (Cell Signalling Technology) and anti-FLAG antibody (Clontech). Horseradish peroxidase-conjugated secondary antibodies and anti-rabbit and anti-mouse antibodies were acquired from Molecular Probes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The following antibodies were used: Anti-GFP antibody (JL-8 from Takara, Shiga, Japan), anti-Flag antibody (M2 from Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-GFP antibody (Clontech) for 1 hour at room temperature followed by a second incubation with HRP-conjugated secondary antibody (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal Antibody (JL-8) (Clontech). Anti-mouse IgG was used as a secondary antibody.
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Cell Biology 2021Quote: ... 1982) or a commercial antibody against dsRed that detects mCherry (Living Colors DsRed Polyclonal Antibody, Clontech). After 3 consecutive 5-min washes in PBS ...
-
bioRxiv - Plant Biology 2019Quote: Primary antibodies were monoclonal antibodies from mouse: α-GFP (JL-8, 1:5000, Takara, Shiga, Japan) or rat ...
-
bioRxiv - Neuroscience 2023Quote: ... a mix of an mCherry-DsRed rabbit polyclonal antibody (Living Colors-Clontech Antibody 632496, 1:1000) and a mouse monoclonal antibody against oxytocin (P38 ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were maintained at 37 °C in a humidified atmosphere at 5% CO2 in DMEM 4.5g/L Glucose with UltraGlutamine media supplemented with 10% of Tet-free FBS (Clontech) and 1% penicillin/streptomycin.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... combined with TaqStart Antibody (639250, Takara Bio Europe ...
-
bioRxiv - Microbiology 2019Quote: ... Rabbit anti-GFP antibody (Clontech #632377) was used at 1:5,000 dilution ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-mCherry antibody (#Z2496N, TaKaRa), or a horseradish peroxidase-conjugated anti-α-tubulin antibody (#HRP-66031 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.22 µg TaqStart Antibody (Clontech). 45-50 cycles of amplification were performed on a Bio-Rad C1000 thermocycler and the resulting product visualized with ethidium bromide on a 2% agarose gel.
-
bioRxiv - Plant Biology 2022Quote: ... The anti-GFP antibody (TaKaRa, 632381), the anti-LhcB2 antibody (Agrisera ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti GFP antibody (Clontech, lot. 1404005) and anti-H3 (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: ... Monoclonal Antibody (JL-8) (632381; Clontech) in 1:2,000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... Western blotting was performed using standard procedures with the following primary antibodies: JL-8 monoclonal antibody (Takara) for GFP variants ...
-
bioRxiv - Immunology 2023Quote: Primary antibodies used for imaging include Living Colors anti-DsRed Rabbit Polyclonal Pan Antibody (1:500; TaKaRa), Chicken Polyclonal anti-GFP (1:300 ...