Labshake search
Citations for Takara Bio :
101 - 150 of 998 citations for Ig lambda constant 2 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... SD growth medium w/o Ade−His−Leu−Trp− (Himedia) and supplements media (Clontech) were used for the Y2H experiment.
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: ... and then grown on SD-Trp-Leu and SD-Trp-Leu-His plates (Clontech).
-
bioRxiv - Synthetic Biology 2020Quote: ... The protein library was purified using a His-Tagged 96-well plate cartridge (Clontech) and buffer exchanged into 50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a permanent C-terminal His-tag were purified using TALON (Clontech) resin followed by anion exchange using a Hitrap Q column (Cytiva) ...
-
bioRxiv - Biochemistry 2023Quote: ... EPHA2- FN2 and antigen-A were purified using His 60 Ni Superflow resin (Takara), whilst antigen-B was purified with rProteinA Sepharose (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2021Quote: TET-ON stable HEK293 cells with the Tetracycline-inducible expression constructs were grown in DMEM supplemented with 10% TET-approved FCS (Clontech) and induction of expression of respective gene product was carried out for indicated time durations using 400 ng/ml Doxycycline (SIGMA) ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Neuroscience 2022Quote: AAVs were packaged via calcium phosphate transfection of HEK293 cells as detailed in (McClure et al 2011) and purified using an AAVpro purification kit (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP 61,62 (400ng) using TransIT-LT1 (Takara, Cat# MIR2306). On day 3 (24 hours post transfection) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Both soluble and insoluble (cell pellet) fractions were purified via His-IDA nickel column (Clontech Laboratories ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the SMARTer Stranded Total RNA HI Mammalian kit (Takara 634873) with 0.5-1ug of RNA and samples were sequenced on the NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...
-
bioRxiv - Biophysics 2023Quote: WT and R203M N175-245were purified using the TALON His-tag purification protocol (Clontech Laboratories). Cell pellets were lysed in high salt buffer (50 mM tris ...
-
bioRxiv - Plant Biology 2023Quote: ... The yeast transformants were grown on nutrient-restricted (without Trp, Leu, His, Ade) mediums (Clontech) 3-5 days to assess interactions between various protein combinations.
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human MPS1 and NSL1 were amplified from Human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). To prepare target cells ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were harvested and purified using TALON His-Tag Purification protocol (Clontech Laboratories, Mountain View, CA.) The SUMO tag was cleaved by Ulp-1 as described above and the protein was further purified using ion-exchange chromatography (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Plant Biology 2020Quote: ... The E.coli-expressed tNPR1-His protein was extracted and purified using TALON Metal Affinity Resin (Clontech). For rabbit immunization ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases ...
-
bioRxiv - Molecular Biology 2019Quote: ... the fragment were ligated into the Xho I and Bam HI sites of pEGFP-N3 (Clontech), creating Aβ fused in frame to the N-terminus of GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... pAcGFP-His-MAP2C without AcGFP was amplified and Dendra2 was amplified from pDendra2-C vector (Takara). Dendra2 was inserted into where AcGFP was by In-Fusion cloning kit ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... and human WT hP-NPO cDNA was amplified from human brain cDNA library (TaKaRa, Cat #637242) with primers ...
-
bioRxiv - Cell Biology 2021Quote: ... The nucleotide sequence encoding for human CyPD was obtained from a Human cDNA placenta library (Clontech) by PCR ...
-
bioRxiv - Microbiology 2020Quote: Human embryonic kidney 293T (Clontech, 632180), human lung carcinoma A549 (ATCC ...
-
bioRxiv - Plant Biology 2019Quote: Each purified protein preparation of His-PHOT1 N2 and N4 was incubated with TALON Magnetic Beads (TaKaRa) at 4°C for 30 min and further incubated at 4°C for 30 min with in vitro transcription and translation reactant containing RPT2 N ...
-
bioRxiv - Cell Biology 2022Quote: ... The library was generated by using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Clontech) with 1 μg RNA as input ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Pathology 2020Quote: ... RBD-scFv was purified from the supernatant using Capturem™ His-Tagged Purification Miniprep Kit (Takara Bio). One prep of 800 μL supernatant through one column of the kit yielded 102 μg/mL of RBD-scFv measured by NanoDrop™ 2000/2000c Spectrophotometers (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech) supplemented with 40mg/LX-α-gal (5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside ...
-
bioRxiv - Bioengineering 2021Quote: ... Human umbilical vein endothelial cells (HUVECs) and human aortic smooth muscle cells (HAoSMCs) were purchased from TAKARA BIO (Tokyo ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.25 x105 cells/cm2 were immediately added to each well with HEK293 maintenance media modified with 10% tetracycline-free FBS (Takara Bio, Cat. No. 631367). After 24 h ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human full-coding KATNA1 cDNA was isolated from a human fetal brain Marathon-ready cDNA collection (Clontech, Invitrogen) with the following forward and reverse primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Molecular Biology 2023Quote: ... and RNA-sequencing libraries were made using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara). Libraries were sequenced at the Bauer Core Facility (Harvard University ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were prepared with the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara #634875). 75 bp single-end sequencing was performed using an Illumina NextSeq500 system at the CRI at UT Southwestern Sequencing Facility ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio USA, Inc.), which incorporates both RiboGone and SMART (Switching Mechanism At 5’ end of RNA Template ...