Labshake search
Citations for Takara Bio :
451 - 500 of 889 citations for IL 3 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Shortly, hiPSC lines (C1, C2, C3) and the commercial human iPSC-line Chipsc4 (Takara, Sweden) were cultured and differentiated into cortical NSCs as described elsewhere (23) ...
-
bioRxiv - Cell Biology 2022Quote: Full length wild type human RORβ (NM_006914.3) was subcloned into the pLPCX retroviral vector (Clontech) using XhoI and NotI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2019Quote: PtK2 GFP-α-tubulin cells (stable line expressing human α-tubulin in pEGFP-C1; Takara Bio Inc. ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA encoding human full-length MuSK was cloned into pIRES2-EGFP plasmid vector (Clontech). AChR and MuSK vectors were kindly provided by Drs ...
-
bioRxiv - Neuroscience 2022Quote: 50 µg of human cerebral cortex lysate (Protein Medley, Takara, Kusatsu, Japan, Cat. No. 635323) were diluted and prepared according to manufacturer’s instructions (protocol PT1602-1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The bait stain was combined with a Mate & Plate™ Human Heart library (Takara Bio) for 24 hours after which cells were plated on selective synthetic defined (SD ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Aurora A and TPX2 were amplified from human testis cDNA (Marathon cDNA, Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... and SOX4 were amplified from a reverse transcript of Human Fetal Brain Total RNA (Takara) by high-fidelity PCR using Phusion DNA Polymerases (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Developmental Biology 2023Quote: ... The ORF of human KIF23 was cloned within pCAX vector using In-Fusion system (TaKaRa). The disease associated c.755T>A mutation was introduced to human KIF23 cDNA by the PCR-based mutagenesis as described (Xia et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Bioengineering 2019Quote: The promoter of the HSPA6 gene (Uniprot P17066) was amplified from human genomic DNA (Clontech #636401) from −1231 bp to +119 bp relative to the transcriptional start site ...
-
bioRxiv - Biochemistry 2019Quote: Human LRAT cDNA was synthesized and cloned into a pcDNA3.1(+) vector (Clontech, Palo Alto, California, USA) by a third party (GeneArt ...
-
bioRxiv - Cancer Biology 2019Quote: ... The human patient PDX cell lines were maintained in RPMI-1640 medium containing 10% FBS (Clontech). KRAS mutation status ...
-
bioRxiv - Biochemistry 2020Quote: ... Human IFITM3 cDNA was purchased from Open Biosystems and PCR cloned into pCMV-HA vector (Clontech). All mutants of IFITM3 were generated by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio) for the cells following manufacturer protocol.
-
bioRxiv - Genomics 2022Quote: ... 100 ng of polyA selected RNA from the human lung carcinoma cell line A549 (Takara #636141) was used as input ...
-
bioRxiv - Physiology 2022Quote: ... the cDNAs of full length human GCNA or IDR hGCNA were cloned into pEGFP-C1 (Clontech) between BglII and SalI sites ...
-
bioRxiv - Genetics 2019Quote: Regions orthologous to human placental igDMR were PCR-amplified with TaKaRa EX Taq HS (TaKaRa Bio) with primers specific for chimpanzee and rhesus macaque CGIs (Supplementary Table 4) ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs for C-terminal GFP-tagged human RHBDL4 were generated by subcloning into pEGFP-N1 (Clontech). For generating point mutants ...
-
bioRxiv - Cell Biology 2020Quote: Human sparc cDNA clone was described by us before 29 and subcloned into pShuttle vector (Clontech). Adenovirus expressing human SPARC was constructed using Adeno-X expression system (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... OCIAD1 was initially cloned from human cDNA into a pAcGFP-N1 vector (Clontech, Mountain View, CA). The GFP1-10 vectors were cloned by Gibson assembly into a FUGW lentiviral backbone (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... the cDNA encoding human Wt-syn was introduced into a vector from Clontech (Mountain View, CA) containing the mRFP sequence ...
-
bioRxiv - Cancer Biology 2023Quote: PDGF-IRES-Cre was generated by cloning human PDGF-B and Cre into pQXIX vector (Clontech) as previously described5 ...
-
bioRxiv - Biophysics 2023Quote: Human cell lines used in this study include U2OS and Lenti-X 293T (Takara Bio USA). Lenti-X 293T cells were only used for virus production ...
-
bioRxiv - Immunology 2023Quote: ... The human J chain was replaced with the DsRed2 gene of pDsRedN1 (Takara Bio, Shiga, Japan). The pIgR gene was inserted into the pEF-Myc-His vector (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA fragments larger than 3 kb were amplified with PrimeSTAR Max (Clontech Laboratories, Inc.); all other PCR products were amplified with PrimeSTAR HS DNA polymerase (Clontech Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... 9.0 μL of 3 SMART™ CDS Primer II A (12 M, Clontech, 634936), and 1.4 μL of Loading Reagent (20X ...