Labshake search
Citations for Takara Bio :
451 - 500 of 741 citations for IL 3 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Neuroscience 2022Quote: The Yeast-Two-Hybrid screening for Jacob interaction partners was performed using a pretransformed human brain cDNA Library in pACT2 (Matchmaker-GAL4 Two-Hybrid II; Clontech) as described previously (Helmuth et al. ...
-
bioRxiv - Microbiology 2019Quote: Total RNA of the human multiple myeloma cell line KMM-1 was extracted with RNAiso Plus (Takara Bio, Shiga, Japan). A 24-nt RNA ...
-
bioRxiv - Immunology 2019Quote: ... Rab 5 and Rab 7 cDNA (a gift of M. Sandor) and human CD81 cDNA (Open Biosystems) were cloned into pmCherry-N1 vector (Clontech). Raji/DC-SIGN cells were electroporated with 1 µg of indicated plasmid using the Eppendorf Multiporator in iso-osmolar electroporation buffer using a 90 µs ...
-
bioRxiv - Cell Biology 2019Quote: ... The coding sequences of these small GTPase proteins were amplified with polymerase chain reaction (PCR) using KOD-Plus-Neo DNA polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as template cDNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human ZNRF2 was obtained from the Orfeome clone collection (ID 47920) and transferred by Gateway cloning into pGBT9-GW (Clontech). GAD-E2 and GBD-E3 constructs were combined by transformation into PJ69-4α and PJ69-4a ...
-
bioRxiv - Cell Biology 2020Quote: ... of human ACLY was PCR amplified from a HeLa cDNA pool and inserted into the EcoRI-digested pLVX-puro vector (Takara) using the In-Fusion cloning system (Takara) ...
-
bioRxiv - Microbiology 2021Quote: For human ectopic expression plasmids: Full length cDNA for each gene was amplified from a HeLa cDNA library (Takara Bio) and inserted into a pCDNA expression plasmid modified with either a C-terminal HA or N-terminal V5 tag under the human cytomegalovirus (CMV ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids encoding GST-BVR (GST-BVRα) and GST-BVRβ were generated by cloning cDNA of human BLVRA and BLVRB into pCMV-GST vector (Clontech/TaKaRa). The construct encoding myc-FAK was generated as previously described (95) ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-002 encodes a C-terminal FLAG-tagged version of human PKR hosted in the retroviral expression vector pLPCX (Clontech) and was generated by cloning a PCR product (PCRP ...
-
bioRxiv - Microbiology 2023Quote: A yeast screen for human cellular interacting proteins of pUL136 was performed using the Matchmaker Gold Yeast Two-Hybrid System (Clontech) and the Mate and Plate Universal Human Library (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: ... was generated by amplifying the coding sequence of human EL from cDNA (LIPG; MGC MHS6278-202806078) and inserting it into the vector pCDNA6 using InFusion cloning (Clontech). An EL containing a T111I mutation (pKS17 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-DsRed-Monomer-N1–hVMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pLVX-DsRed-Monomer-N1 (CLONTECH cat. 632152). pLenti–VMP1–GFP was obtained by cloning the VMP1 sequence (NCBI reference sequence ...
-
bioRxiv - Biochemistry 2023Quote: ... FL-human KANK1 (generous donation from the Bershadsky lab) cDNA was tagged in the C-terminal site with pmCherry (Clontech) by restriction digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragments encoding human zyxin were amplified from the cDNA of U2OS cells and then inserted into the pmCherry-N1 vector (Clontech) for the expression of zyxin-RFP.
-
bioRxiv - Cell Biology 2023Quote: ... The PISD-FLAG plasmid was generated by amplifying human PISD from cDNA and cloning it into the BglII and SalI sites of the pmCherry-N1 vector (Clontech). The C-terminal mCherry tag was subsequently replaced with 3xFLAG tag using the AgeI and NotI restriction sites ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald/ mApple -VTA1: full-length human VTA1 was amplified by PCR and cloned to mEmerald or mApple -C1 vectors (Clontech). mCh-CHMP4C ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Synthetic Biology 2024Quote: WT Human Embryonic Kidney (HEK) 293 cells (ATCC, catalog no. CRL-1573) and HEK293T-LentiX (Takara Biosciences, catalog no. 632180) were cultured in a humidity-controlled incubator under standard culture conditions (37 °C with 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Systems Biology 2024Quote: SW1353 cells were purchased from ATCC Full length miRNA target 3’UTRs were amplified from human genomic DNA using PCR primers (Supplementary Table 4) to enable Clontech In-Fusion HD cloning (Takara Bio Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... and the 3’- M6 fragment and the sfGFP fragment were inserted using In-fusion cloning (homologous recombination; TaKaRa). The resulting M6-sfGFP insert was excised using NotI and KpnI and ligated into pUASt-attB [38] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3⍰×⍰105 cells were reverse transfected with 2μg of UniSAM DNA using the Xfect Transfection reagent (Clontech) and plated into a coated 6 well plate ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Plant Biology 2024Quote: ... and inserted into BamHI-digested pGEX-4T-3 by using In-Fusion Smart Assembly Cloning Kit (Takarabio-Clontech). Full-length OcKSL4 cDNA was amplified by RT-PCR using primers 5’-GGATCCATGGCGAATTATCCCATGGAG-3’ (forward ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Genomics 2019Quote: ... We additionally PCR amplified the region from genomic DNA for sample NA12878 with 12 copies of AC (NIGMS Human Genetic Repository, Coriell) using PrimeSTAR max DNA Polymerase (Clontech R045B) and primers RFT1eSTR_F and RFT1eSTR_R (Supplementary Table 8 ...
-
bioRxiv - Cell Biology 2019Quote: ... was produced by cloning a gene block (IDT) comprising a human codon optimized C10 Δ(45 - 69) into a YFP-N1 vector (Clontech) digested with NotI and BamHI to replace the YFP insert ...
-
bioRxiv - Neuroscience 2020Quote: Bacterial expression plasmids encoding mouse and human WT-α-synuclein in the inducible pRK172 backbone were transformed into BL21-CodonPlus (DE3) cells (Clontech). Cell pellets were lysed in 0.75M NaCl ...