Labshake search
Citations for Takara Bio :
1 - 50 of 266 citations for IL 22 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Cellartis® human iPSC line 22 (ChiPSC22) was obtained from Takara, expanded and cultured using Cellartis DEF-CS Culture System following Cellartis protocol.
-
bioRxiv - Systems Biology 2020Quote: ... A second 22-cycle PCR was performed with PrimeSTAR HS polymerase (Takara) in 20 125 μL reactions ...
-
bioRxiv - Neuroscience 2019Quote: Neurons at 22 DIV were transfected with an eGFP-N2 plasmid (Clontech, Kyoto, Japan) using Lipofectamine 2000 for 24 hours ...
-
bioRxiv - Physiology 2024Quote: ... cDNAs were subcloned into pGEMHE (22) using the In-Fusion Snap Assembly Master Mix (Takara Bio, Shiga, Japan) with gene-specific primers and 15-bp sequences complementary to the ends of the linearized pGEMHE (Table S4 ...
-
bioRxiv - Microbiology 2020Quote: ... The transgenes were inserted between the P and M gene of pNDV LaSota (LS) wild type or the L289A (15, 22, 23) mutant (NDV_LS/L289A) antigenomic cDNA by in-Fusion cloning (Clontech). The recombination products were transformed into NEB® Stable Competent E ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified from genomic DNA with primers 19-22 and cloned into the vector pRS29 using ligation-independent cloning (In-Fusion, Clontech). A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG85 using primers 23 and 24 ...
-
bioRxiv - Neuroscience 2022Quote: ... washed with 200 µL water, and resuspended in PCR mix (22 µL water, 25 µL Terra PCR direct buffer, 1 µL Terra Polymerase (Takara), 1 µL 100 M Truseq PCR handle primer ...
-
bioRxiv - Biophysics 2020Quote: ... containing either tetra-acetylated or unmodified histone H4 was digested for 5 min at 22 °C with micrococcal nuclease (MNase) (0.125 to 2.0 units; Takara, cat. #2910A) in 5.5 mM Tris-HCl buffer (pH 7.6 ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA synthesis and subsequent cDNA amplification by 22 cycles of polymerase chain reaction (PCR) were performed using the SMARTer stranded RNA-seq kit (Takara). The synthesized first-strand cDNA and amplified cDNA were purified using Ampure XP Beads (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2022Quote: ... Beads were resuspended in 200 uL Template Switch mix (88 uL water, 44 uL 5x Maxima buffer, 44 uL 20% Ficoll PM-400, 22 uL 10 mM Takara dNTPs ...
-
bioRxiv - Plant Biology 2023Quote: ... the strain carrying the pLBD16::AbAi bait was tested for autoactivation by using empty prey strains carrying empty vector of pDEST-22 under various concentrations of Aureobasidin A (AbA) (Takara) (0 ...
-
bioRxiv - Bioengineering 2020Quote: ... genes encoding CAR constructs were purchased as gblocks (IDT) (21, 22) and amplified by PCR and cloned into the pCDH vector using Infusion cloning tools (Takara Bio, Kusatsu, Japan). Sequences for all clones used in subsequent experiments were confirmed by sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... MYC (mouse, Clontech, 631206 ...
-
bioRxiv - Genomics 2019Quote: ... and the expression of IFN-β and IL-6 were measured by quantitative PCR (TAKARA, RR820A). The sequences of the primers were listed in the Supplementary Table 4.
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti dsRed (Clontech) 1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-mCherry (Takara Bio ...
-
bioRxiv - Synthetic Biology 2022Quote: ... mouse anti-TetR (Clontech; 9G9 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-dsred (Takara), rabbit anti-GFP (Proteintech) ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-His6 (Clontech, 631212). Anti-Flag beads were purchased from SIGMA.
-
bioRxiv - Genetics 2019Quote: ... mouse Gla-Osteocalcin (MK127; Takara), mouse Osteopontin (MOST00 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-mCherry (Clontech, 632543) 1:200 ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-GFP (Clontech, 632381), 1:10,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse-STEM101 (Takara Bio). Imaging was performed using Zeiss LSM880 or LSM900 confocal microscopes ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry (Clontech, 632543) at 1:450 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse fibroblast NIH-3T3 (Takara), human retinal pigment epithelial cells (hTERT-RPE1 or RPE1 ...
-
bioRxiv - Cell Biology 2024Quote: ... total mouse liver mRNA (Takara) was used.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Cell Biology 2019Quote: ... Mouse Ca14 coding sequence was amplified from mouse B16 cDNA and cloned in mcherryN1 vector (Clontech) in KpnI/HindIII site ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse JL8 anti-GFP (Clontech, 632381); mouse P124 anti-desmoglein 1 (Progen ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Clontech, 1:5000) rat anti-RFP (Chromotek ...
-
bioRxiv - Pathology 2022Quote: ... Rat anti Mouse OCN (Takara, M188); Rabbit anti Mouse MGST1 (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP monoclonal JL8 (Clontech), mouse anti-myc (Cell Signaling Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... His6 (631212, Clontech, mouse, 1:500); NPL4 (sc-365796 ...
-
bioRxiv - Microbiology 2023Quote: ... We used mouse anti-GFP (Takara) at 1:1000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Clontech,1:6,000), mouse anti-FLAG (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mCherry 1:500 (632543, Clontech); chicken anti-Gfp 1:500 (ab13970 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:1000; Clontech #632460), rabbit anti-somatostatin (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti GFP (#632381, Takara Bio Clontech), mouse anti Vinculin (#V9131-100UL ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti GFP (#632381, Takara Bio Clontech), mouse anti Vinculin (#V9131-100UL ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunohistochemistry for mCherry (mouse, 1:1000, Takara; goat anti-mouse-alexa594 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse-anti-mCherry (Clontech, 632543 1:1000). Secondary antibodies ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:200; Clontech #632381) overnight at 4⁰C ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-Cherry (1:500; Clontech, 632543), Rabbit anti-Gat (1:4,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Clone JL-8; Clontech) at 1:1,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: ... or mouse α-GFP antibody (632381, Takara) were diluted 1:2000 in Odyssey Blocking Buffer (PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-STEM121 (Takara, Y40410, 1:250), goat anti-ChAT (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-mCherry (632543, Clontech; 1:500), mouse anti-GFP (ab1218 ...
-
bioRxiv - Biochemistry 2024Quote: ... GFP (mouse, Clontech cat# 632380; 1:2,000); FLAG (mouse ...